Incidental Mutation 'R4535:Vmn2r70'
ID333290
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85565333 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 204 (W204R)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably damaging
Transcript: ENSMUST00000168230
AA Change: W204R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: W204R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATTATGGGAGAGTCTTTGTATCC -3'
(R):5'- CTCGCATGAATATACTTTGCTCAAG -3'

Sequencing Primer
(F):5'- TGGGAGAGTCTTTGTATCCATAAAC -3'
(R):5'- GCTCAAGCAAAATCTGATCTTACAAG -3'
Posted On2015-08-18