Incidental Mutation 'R4535:Fyco1'
ID333294
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123838888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000133222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000184082]
Predicted Effect probably damaging
Transcript: ENSMUST00000084715
AA Change: V91A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: V91A

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000167595
AA Change: V91A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: V91A

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183700
Predicted Effect probably damaging
Transcript: ENSMUST00000184082
AA Change: V91A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241
AA Change: V91A

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216136
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
BB009:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
BB019:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
PIT4480001:Fyco1 UTSW 9 123828650 nonsense probably null
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1184:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4120:Fyco1 UTSW 9 123825626 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5522:Fyco1 UTSW 9 123794771 nonsense probably null
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense probably damaging 0.98
R7205:Fyco1 UTSW 9 123822426 missense probably benign 0.00
R7932:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
R8086:Fyco1 UTSW 9 123830406 missense probably damaging 1.00
R8103:Fyco1 UTSW 9 123829388 missense probably benign 0.17
Z1177:Fyco1 UTSW 9 123828323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTTTCCATGAGCTTGAACCAC -3'
(R):5'- GCTTGTCCCTAGGAAGCTAG -3'

Sequencing Primer
(F):5'- GTTTCCATGAGCTTGAACCACATAAC -3'
(R):5'- CTTGTCCCTAGGAAGCTAGTAATG -3'
Posted On2015-08-18