Incidental Mutation 'R4535:Xrcc3'
ID333297
Institutional Source Beutler Lab
Gene Symbol Xrcc3
Ensembl Gene ENSMUSG00000021287
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111803192-111813873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111804532 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 321 (L321P)
Ref Sequence ENSEMBL: ENSMUSP00000021715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021715] [ENSMUST00000084941] [ENSMUST00000122300] [ENSMUST00000127281] [ENSMUST00000134578]
Predicted Effect probably damaging
Transcript: ENSMUST00000021715
AA Change: L321P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021715
Gene: ENSMUSG00000021287
AA Change: L321P

DomainStartEndE-ValueType
Pfam:Rad51 64 343 1.2e-25 PFAM
Pfam:AAA_25 70 261 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084941
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122300
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124064
Predicted Effect probably benign
Transcript: ENSMUST00000127281
SMART Domains Protein: ENSMUSP00000118040
Gene: ENSMUSG00000021287

DomainStartEndE-ValueType
Pfam:Rad51 64 193 4e-17 PFAM
Pfam:AAA_25 70 192 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147203
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. Allelic variants in the human gene are associated with susceptibility to breast cancer and cutaneous malignant melanoma. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Other mutations in Xrcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:Xrcc3 UTSW 12 111809957 missense probably benign 0.00
R4534:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R5406:Xrcc3 UTSW 12 111812111 missense probably damaging 0.99
R5762:Xrcc3 UTSW 12 111804610 missense probably damaging 0.97
R5842:Xrcc3 UTSW 12 111804530 missense possibly damaging 0.94
R5937:Xrcc3 UTSW 12 111807972 missense probably null 0.51
R6985:Xrcc3 UTSW 12 111812096 missense probably damaging 0.98
R7011:Xrcc3 UTSW 12 111804535 missense probably damaging 1.00
R7560:Xrcc3 UTSW 12 111807902 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCAGATACTGACAGACTAACCG -3'
(R):5'- GACATGGTGGGCTGTACAAG -3'

Sequencing Primer
(F):5'- TGACAGACTAACCGTCACTGGG -3'
(R):5'- AGCACCAACACTCATTTTGTG -3'
Posted On2015-08-18