Incidental Mutation 'R4535:Azin1'
ID333303
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Nameantizyme inhibitor 1
SynonymsODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik
Accession Numbers

Genbank: NM_018745; MGI: 1859169

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location38487427-38519266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38493605 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 258 (I258N)
Ref Sequence ENSEMBL: ENSMUSP00000105958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]
Predicted Effect probably benign
Transcript: ENSMUST00000065308
AA Change: I258N

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: I258N

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110328
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110329
AA Change: I258N

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: I258N

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129589
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38493486 missense probably benign
IGL02406:Azin1 APN 15 38491565 missense probably benign 0.00
H2330:Azin1 UTSW 15 38497276 missense probably damaging 0.98
R0562:Azin1 UTSW 15 38493581 missense probably benign 0.00
R3416:Azin1 UTSW 15 38493546 missense possibly damaging 0.89
R3434:Azin1 UTSW 15 38493576 missense probably benign 0.00
R3978:Azin1 UTSW 15 38498713 missense probably damaging 0.99
R4720:Azin1 UTSW 15 38493500 missense probably benign 0.43
R5266:Azin1 UTSW 15 38491551 missense probably benign
R6416:Azin1 UTSW 15 38492343 missense possibly damaging 0.71
R7242:Azin1 UTSW 15 38501505 start codon destroyed probably null 1.00
R7283:Azin1 UTSW 15 38501408 missense probably damaging 0.98
R7577:Azin1 UTSW 15 38501421 missense probably benign 0.01
R7604:Azin1 UTSW 15 38491634 missense probably damaging 1.00
R8221:Azin1 UTSW 15 38492328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATCCAATACAAGAGGAATG -3'
(R):5'- GCTGTTGTGACTGTTACCAAATAAC -3'

Sequencing Primer
(F):5'- CAAGGTGGTGTGGTTGTATCTAAAAC -3'
(R):5'- GTTACCAAATAACAGTAAAAGCTTGC -3'
Posted On2015-08-18