Incidental Mutation 'R4535:Ttll2'
ID 333306
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Name tubulin tyrosine ligase-like family, member 2
Synonyms EG625850
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R4535 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 7618284-7620095 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7619120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 269 (I269N)
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
AlphaFold A4Q9E4
Predicted Effect probably benign
Transcript: ENSMUST00000115747
AA Change: I269N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722
AA Change: I269N

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,762,162 (GRCm39) S473P unknown Het
Azin1 A T 15: 38,493,849 (GRCm39) I258N probably benign Het
Bod1l G A 5: 41,989,574 (GRCm39) A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,736,933 (GRCm39) probably benign Het
Cd200r3 T A 16: 44,774,552 (GRCm39) D188E probably benign Het
Cd4 A T 6: 124,847,414 (GRCm39) F250Y probably benign Het
Clcn4 T A 7: 7,290,813 (GRCm39) Y662F probably benign Het
Cpa2 T C 6: 30,552,020 (GRCm39) V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 33,067,751 (GRCm39) probably benign Het
Dhx57 A G 17: 80,582,511 (GRCm39) Y365H probably damaging Het
Dsg1c A G 18: 20,408,322 (GRCm39) E457G probably benign Het
Eef2k T A 7: 120,457,822 (GRCm39) Y60* probably null Het
Efcc1 A G 6: 87,730,133 (GRCm39) D482G probably null Het
Exoc4 C T 6: 33,254,179 (GRCm39) R112C probably damaging Het
Fam178b A T 1: 36,639,606 (GRCm39) D293E probably benign Het
Fbxl21 G A 13: 56,674,873 (GRCm39) V49I probably damaging Het
Fyco1 A G 9: 123,667,953 (GRCm39) V91A probably damaging Het
H2-M10.4 T C 17: 36,772,736 (GRCm39) E82G probably damaging Het
Hmcn1 A G 1: 150,439,531 (GRCm39) I5434T probably damaging Het
Hormad1 T C 3: 95,492,452 (GRCm39) V343A probably benign Het
Incenp T C 19: 9,861,303 (GRCm39) N450S unknown Het
Iqsec3 T C 6: 121,356,977 (GRCm39) K1035E possibly damaging Het
Ltn1 A T 16: 87,223,174 (GRCm39) V102D probably damaging Het
Mcur1 T C 13: 43,698,016 (GRCm39) T295A probably damaging Het
Pals1 A T 12: 78,871,611 (GRCm39) D397V possibly damaging Het
Pcdha3 T C 18: 37,081,013 (GRCm39) V585A probably damaging Het
Plcd4 A G 1: 74,602,627 (GRCm39) T594A probably damaging Het
Ppp1r3c T C 19: 36,711,522 (GRCm39) K83E probably damaging Het
Sesn3 C A 9: 14,233,954 (GRCm39) T309K probably benign Het
Slc38a3 T C 9: 107,533,405 (GRCm39) N251S probably benign Het
Sptbn4 A G 7: 27,067,127 (GRCm39) V614A probably damaging Het
Srsf4 A G 4: 131,601,175 (GRCm39) K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 (GRCm39) N32S possibly damaging Het
Utp3 T C 5: 88,703,458 (GRCm39) V329A probably benign Het
Vmn2r102 A G 17: 19,914,975 (GRCm39) T847A probably benign Het
Vmn2r70 A T 7: 85,214,541 (GRCm39) W204R probably damaging Het
Xrcc3 A G 12: 111,770,966 (GRCm39) L321P probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7,619,130 (GRCm39) missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7,618,779 (GRCm39) missense probably benign 0.05
R1922:Ttll2 UTSW 17 7,619,789 (GRCm39) missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7,619,522 (GRCm39) missense probably benign 0.03
R2892:Ttll2 UTSW 17 7,620,098 (GRCm39) splice site probably null
R4388:Ttll2 UTSW 17 7,618,599 (GRCm39) nonsense probably null
R4389:Ttll2 UTSW 17 7,618,599 (GRCm39) nonsense probably null
R4534:Ttll2 UTSW 17 7,619,120 (GRCm39) missense probably benign 0.02
R4536:Ttll2 UTSW 17 7,619,120 (GRCm39) missense probably benign 0.02
R4868:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R4870:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R4871:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R5990:Ttll2 UTSW 17 7,619,766 (GRCm39) missense possibly damaging 0.95
R6145:Ttll2 UTSW 17 7,619,031 (GRCm39) missense probably benign 0.08
R6332:Ttll2 UTSW 17 7,619,167 (GRCm39) missense probably damaging 1.00
R7893:Ttll2 UTSW 17 7,619,490 (GRCm39) missense probably benign 0.15
R8250:Ttll2 UTSW 17 7,618,767 (GRCm39) missense probably benign 0.00
R8673:Ttll2 UTSW 17 7,619,340 (GRCm39) missense possibly damaging 0.81
R9036:Ttll2 UTSW 17 7,619,054 (GRCm39) missense probably benign 0.01
R9429:Ttll2 UTSW 17 7,620,085 (GRCm39) missense probably damaging 1.00
R9455:Ttll2 UTSW 17 7,619,692 (GRCm39) missense probably damaging 1.00
R9773:Ttll2 UTSW 17 7,618,676 (GRCm39) missense probably benign 0.17
R9784:Ttll2 UTSW 17 7,618,707 (GRCm39) missense probably benign 0.01
RF010:Ttll2 UTSW 17 7,618,737 (GRCm39) missense probably benign 0.05
Z1088:Ttll2 UTSW 17 7,618,925 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCACGGTTTCAGGTTATC -3'
(R):5'- AGGTACAAATGCGACCTCCG -3'

Sequencing Primer
(F):5'- CGGTTTCAGGTTATCATCAATAAGG -3'
(R):5'- GCATCTATGTCTGCATCACTGG -3'
Posted On 2015-08-18