Incidental Mutation 'R4535:Ttll2'
ID333306
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Nametubulin tyrosine ligase-like family, member 2
SynonymsEG625850
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location7350885-7352696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7351721 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 269 (I269N)
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
Predicted Effect probably benign
Transcript: ENSMUST00000115747
AA Change: I269N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722
AA Change: I269N

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7351731 missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7351380 missense probably benign 0.05
R1922:Ttll2 UTSW 17 7352390 missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7352123 missense probably benign 0.03
R2892:Ttll2 UTSW 17 7352699 splice site probably null
R4388:Ttll2 UTSW 17 7351200 nonsense probably null
R4389:Ttll2 UTSW 17 7351200 nonsense probably null
R4534:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4536:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4868:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4870:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4871:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R5990:Ttll2 UTSW 17 7352367 missense possibly damaging 0.95
R6145:Ttll2 UTSW 17 7351632 missense probably benign 0.08
R6332:Ttll2 UTSW 17 7351768 missense probably damaging 1.00
R7893:Ttll2 UTSW 17 7352091 missense probably benign 0.15
R8250:Ttll2 UTSW 17 7351368 missense probably benign 0.00
RF010:Ttll2 UTSW 17 7351338 missense probably benign 0.05
Z1088:Ttll2 UTSW 17 7351526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCACGGTTTCAGGTTATC -3'
(R):5'- AGGTACAAATGCGACCTCCG -3'

Sequencing Primer
(F):5'- CGGTTTCAGGTTATCATCAATAAGG -3'
(R):5'- GCATCTATGTCTGCATCACTGG -3'
Posted On2015-08-18