Incidental Mutation 'R4535:H2-M10.4'
ID333309
Institutional Source Beutler Lab
Gene Symbol H2-M10.4
Ensembl Gene ENSMUSG00000048231
Gene Namehistocompatibility 2, M region locus 10.4
Synonyms15H
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36458917-36462334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36461844 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000130832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057502] [ENSMUST00000169950]
Predicted Effect probably damaging
Transcript: ENSMUST00000057502
AA Change: E82G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058686
Gene: ENSMUSG00000048231
AA Change: E82G

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 5.7e-45 PFAM
IGc1 222 293 7.45e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169950
AA Change: E82G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130832
Gene: ENSMUSG00000048231
AA Change: E82G

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 8.2e-45 PFAM
IGc1 222 293 7.45e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in H2-M10.4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:H2-M10.4 APN 17 36460467 missense probably damaging 1.00
IGL02651:H2-M10.4 APN 17 36460656 missense probably benign 0.10
IGL02821:H2-M10.4 APN 17 36460431 missense probably damaging 1.00
IGL03123:H2-M10.4 APN 17 36461920 missense probably damaging 0.99
IGL03171:H2-M10.4 APN 17 36461250 missense probably damaging 0.98
R0206:H2-M10.4 UTSW 17 36460483 missense probably damaging 1.00
R0208:H2-M10.4 UTSW 17 36460483 missense probably damaging 1.00
R3979:H2-M10.4 UTSW 17 36461985 missense probably benign 0.23
R4685:H2-M10.4 UTSW 17 36461796 missense probably benign 0.23
R4702:H2-M10.4 UTSW 17 36461982 missense probably benign 0.25
R5390:H2-M10.4 UTSW 17 36460641 missense probably damaging 1.00
R5945:H2-M10.4 UTSW 17 36460626 missense probably benign 0.01
R8135:H2-M10.4 UTSW 17 36461770 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTGAATCTCTGACTTGAGG -3'
(R):5'- GAAGGGTCAGGGTCTCAATGTG -3'

Sequencing Primer
(F):5'- CTGAATCTCTGACTTGAGGACCTAG -3'
(R):5'- TCAGGGTCTCAATGTGCACCAC -3'
Posted On2015-08-18