Mutagenetix > Incidental Mutations

Incidental Mutation 'R4535:Dhx57'

333310

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R4535 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80275082 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 365 (Y365H)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038166
AA Change: Y312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: Y312H

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086555
AA Change: Y365H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: Y365H

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef4	T	C	1: 34,723,081	S473P	unknown	Het
Azin1	A	T	15: 38,493,605	I258N	probably benign	Het
Bod1l	G	A	5: 41,832,231	A383V	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cd200r3	T	A	16: 44,954,189	D188E	probably benign	Het
Cd4	A	T	6: 124,870,451	F250Y	probably benign	Het
Clcn4	T	A	7: 7,287,814	Y662F	probably benign	Het
Cpa2	T	C	6: 30,552,021	V249A	probably benign	Het
Depdc5	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	5: 32,910,407		probably benign	Het
Dsg1c	A	G	18: 20,275,265	E457G	probably benign	Het
Eef2k	T	A	7: 120,858,599	Y60*	probably null	Het
Efcc1	A	G	6: 87,753,151	D482G	probably null	Het
Exoc4	C	T	6: 33,277,244	R112C	probably damaging	Het
Fam178b	A	T	1: 36,600,525	D293E	probably benign	Het
Fbxl21	G	A	13: 56,527,060	V49I	probably damaging	Het
Fyco1	A	G	9: 123,838,888	V91A	probably damaging	Het
H2-M10.4	T	C	17: 36,461,844	E82G	probably damaging	Het
Hmcn1	A	G	1: 150,563,780	I5434T	probably damaging	Het
Hormad1	T	C	3: 95,585,141	V343A	probably benign	Het
Incenp	T	C	19: 9,883,939	N450S	unknown	Het
Iqsec3	T	C	6: 121,380,018	K1035E	possibly damaging	Het
Ltn1	A	T	16: 87,426,286	V102D	probably damaging	Het
Mcur1	T	C	13: 43,544,540	T295A	probably damaging	Het
Mpp5	A	T	12: 78,824,837	D397V	possibly damaging	Het
Pcdha3	T	C	18: 36,947,960	V585A	probably damaging	Het
Plcd4	A	G	1: 74,563,468	T594A	probably damaging	Het
Ppp1r3c	T	C	19: 36,734,122	K83E	probably damaging	Het
Sesn3	C	A	9: 14,322,658	T309K	probably benign	Het
Slc38a3	T	C	9: 107,656,206	N251S	probably benign	Het
Sptbn4	A	G	7: 27,367,702	V614A	probably damaging	Het
Srsf4	A	G	4: 131,873,864	K34R	probably damaging	Het
Tfpi2	T	C	6: 3,968,044	N32S	possibly damaging	Het
Ttll2	A	T	17: 7,351,721	I269N	probably benign	Het
Utp3	T	C	5: 88,555,599	V329A	probably benign	Het
Vmn2r102	A	G	17: 19,694,713	T847A	probably benign	Het
Vmn2r70	A	T	7: 85,565,333	W204R	probably damaging	Het
Xrcc3	A	G	12: 111,804,532	L321P	probably damaging	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCACAGGAGGAACGCTATAC -3'
(R):5'- CGCCTGAAACCTGTAAATTTTACC -3'

Sequencing Primer
(F):5'- TCACAGGAGGAACGCTATACTTATG -3'
(R):5'- TCAAACATGAAGTGCCCC -3'

Posted On

2015-08-18