Incidental Mutation 'R4535:Ppp1r3c'
ID333314
Institutional Source Beutler Lab
Gene Symbol Ppp1r3c
Ensembl Gene ENSMUSG00000067279
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonymsprotein targeting to glicogen, Ppp1r5, PTG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36731737-36736653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36734122 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 83 (K83E)
Ref Sequence ENSEMBL: ENSMUSP00000084578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087321]
Predicted Effect probably damaging
Transcript: ENSMUST00000087321
AA Change: K83E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084578
Gene: ENSMUSG00000067279
AA Change: K83E

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
Pfam:CBM_21 151 257 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carbohydrate binding protein that is a subunit of the protein phosphatase 1 (PP1) complex. PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities. The encoded protein affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown by reducing glycogen phosphorylase activity. DNA hypermethylation of this gene has been found in colorectal cancer patients. The encoded protein also interacts with the laforin protein, which is a protein tyrosine phosphatase implicated in Lafora disease. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice are embyronic lethal. Heterozygotes have reduced glycogen stores, attenuated glycogen synthesis, glucose intolerance, hyperinsulinemia and insulin resistance. Mice homozygous for a different knock-out allele exhibit normal lifespan with enhanced whole body insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Ppp1r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp1r3c APN 19 36734103 missense probably damaging 1.00
IGL00486:Ppp1r3c APN 19 36733924 missense probably damaging 1.00
IGL01865:Ppp1r3c APN 19 36734178 missense probably benign 0.00
IGL02896:Ppp1r3c APN 19 36733465 missense probably benign 0.26
R0110:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0450:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0456:Ppp1r3c UTSW 19 36733891 nonsense probably null
R0469:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R1539:Ppp1r3c UTSW 19 36733961 missense probably benign
R1859:Ppp1r3c UTSW 19 36733611 missense probably damaging 1.00
R2228:Ppp1r3c UTSW 19 36733698 missense probably benign
R2229:Ppp1r3c UTSW 19 36733698 missense probably benign
R4534:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4619:Ppp1r3c UTSW 19 36734343 missense possibly damaging 0.94
R4630:Ppp1r3c UTSW 19 36733515 missense probably benign 0.02
R6015:Ppp1r3c UTSW 19 36733806 missense probably damaging 1.00
R8206:Ppp1r3c UTSW 19 36733446 missense probably benign 0.10
R8386:Ppp1r3c UTSW 19 36733938 missense probably damaging 1.00
Z1177:Ppp1r3c UTSW 19 36733918 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTTCTTCTGAAAGCGGTCCC -3'
(R):5'- GGACATGGCCATGAGGATTTG -3'

Sequencing Primer
(F):5'- CGGTCCCGGAAACTTAAGTAGTC -3'
(R):5'- GAGGATTTGCTTGGCTCATTCACC -3'
Posted On2015-08-18