Mutagenetix > Incidental Mutation

Incidental Mutation 'R0107:Olfr835'

33332

Institutional Source

Beutler Lab

Gene Symbol

Olfr835

Ensembl Gene

ENSMUSG00000045204

Gene Name

olfactory receptor 835

Synonyms

MOR150-3, GA_x6K02T2PVTD-12771995-12772930

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R0107 (G1)

Quality Score

193

Status

Validated (trace)

Chromosome

Chromosomal Location

19032735-19037670 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19035333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 70 (D70G)

Ref Sequence

ENSEMBL: ENSMUSP00000148416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]

AlphaFold

Q7TRG7

Predicted Effect

probably damaging
Transcript: ENSMUST00000059315
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: D70G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.8e-47	PFAM
Pfam:7TM_GPCR_Srsx	35	206	2.9e-7	PFAM
Pfam:7tm_1	41	303	1.3e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213018
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1339

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Olfr835

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01718:Olfr835	APN	9	19035288	nonsense	probably null
IGL02546:Olfr835	APN	9	19035354	missense	possibly damaging	0.88
R0010:Olfr835	UTSW	9	19035322	missense	probably damaging	1.00
R1867:Olfr835	UTSW	9	19035266	missense	probably benign	0.36
R1891:Olfr835	UTSW	9	19035978	missense	probably damaging	0.99
R1941:Olfr835	UTSW	9	19035866	missense	possibly damaging	0.93
R4152:Olfr835	UTSW	9	19035520	nonsense	probably null
R5451:Olfr835	UTSW	9	19035491	missense	probably damaging	1.00
R5677:Olfr835	UTSW	9	19035558	missense	possibly damaging	0.93
R5970:Olfr835	UTSW	9	19035147	missense	probably benign
R6187:Olfr835	UTSW	9	19035393	missense	probably benign	0.12
R6805:Olfr835	UTSW	9	19035301	missense	probably damaging	1.00
R7183:Olfr835	UTSW	9	19035332	missense	probably damaging	1.00
R8029:Olfr835	UTSW	9	19035794	missense	probably damaging	1.00
R8139:Olfr835	UTSW	9	19035575	missense	probably benign	0.07
R8736:Olfr835	UTSW	9	19035478	missense	probably damaging	1.00
R8868:Olfr835	UTSW	9	19035482	missense	probably damaging	1.00
R8909:Olfr835	UTSW	9	19035592	missense	probably benign	0.08
R9116:Olfr835	UTSW	9	19035477	missense	probably damaging	1.00
R9479:Olfr835	UTSW	9	19035434	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- AGATGATCCAACTGTGAAGCCTGTG -3'
(R):5'- CCATGAGACCAAGAAGTCCCATGTTC -3'

Sequencing Primer
(F):5'- AACTGTGAAGCCTGTGATCTTTTG -3'
(R):5'- GTCCCATGTTCAAAACGCTAATG -3'

Posted On

2013-05-09