Incidental Mutation 'R4536:Tfpi2'
ID333323
Institutional Source Beutler Lab
Gene Symbol Tfpi2
Ensembl Gene ENSMUSG00000029664
Gene Nametissue factor pathway inhibitor 2
SynonymsPP5/TFPI-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location3962595-3988919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3968044 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 32 (N32S)
Ref Sequence ENSEMBL: ENSMUSP00000031674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031674] [ENSMUST00000183682] [ENSMUST00000203257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031674
AA Change: N32S

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031674
Gene: ENSMUSG00000029664
AA Change: N32S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 34 87 2.75e-26 SMART
KU 94 147 1.92e-2 SMART
KU 154 207 1.33e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183682
SMART Domains Protein: ENSMUSP00000139066
Gene: ENSMUSG00000029664

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
KU 30 83 2.75e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203257
SMART Domains Protein: ENSMUSP00000145193
Gene: ENSMUSG00000029664

DomainStartEndE-ValueType
Blast:KU 1 29 3e-12 BLAST
KU 36 89 6.5e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Tfpi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Tfpi2 APN 6 3965407 missense probably benign 0.17
IGL00721:Tfpi2 APN 6 3963414 missense probably benign 0.41
IGL01017:Tfpi2 APN 6 3965359 missense probably benign 0.00
R0391:Tfpi2 UTSW 6 3965460 missense probably benign
R1352:Tfpi2 UTSW 6 3968281 missense probably damaging 1.00
R1620:Tfpi2 UTSW 6 3965507 missense probably benign 0.17
R3441:Tfpi2 UTSW 6 3965504 missense probably benign 0.01
R4183:Tfpi2 UTSW 6 3963926 missense probably damaging 1.00
R4534:Tfpi2 UTSW 6 3968044 missense possibly damaging 0.87
R4535:Tfpi2 UTSW 6 3968044 missense possibly damaging 0.87
R7048:Tfpi2 UTSW 6 3968032 missense probably damaging 1.00
R7870:Tfpi2 UTSW 6 3968281 missense probably damaging 1.00
R7953:Tfpi2 UTSW 6 3968281 missense probably damaging 1.00
Z1177:Tfpi2 UTSW 6 3974633 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCGGTTATGTTCTGTCACC -3'
(R):5'- CAAGGTATCTGCCCAGGATC -3'

Sequencing Primer
(F):5'- ACACTTACTCTCGATACTTCCGCAAG -3'
(R):5'- TGCCCAGGATCCCCCTTG -3'
Posted On2015-08-18