Incidental Mutation 'R4536:Frmd4b'
ID333325
Institutional Source Beutler Lab
Gene Symbol Frmd4b
Ensembl Gene ENSMUSG00000030064
Gene NameFERM domain containing 4B
Synonyms6030440G05Rik, GRSP1
Accession Numbers

Ncbi RefSeq: NM_145148.2; MGI:2141794

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location97286867-97617541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97310732 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 241 (Q241L)
Ref Sequence ENSEMBL: ENSMUSP00000108982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032146] [ENSMUST00000113355] [ENSMUST00000113359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032146
AA Change: Q295L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064
AA Change: Q295L

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113355
AA Change: Q241L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064
AA Change: Q241L

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113359
AA Change: Q249L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064
AA Change: Q249L

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155326
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GRP1-binding protein which contains a FERM protein interaction domain as well as two coiled coil domains. This protein may play a role as a scaffolding protein. [provided by RefSeq, Mar 2014]
Allele List at MGI

All alleles(24) : Targeted(2) Gene trapped(22)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Frmd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Frmd4b APN 6 97308060 missense probably damaging 1.00
IGL01478:Frmd4b APN 6 97328293 missense probably damaging 1.00
IGL01760:Frmd4b APN 6 97308702 missense probably damaging 1.00
IGL01777:Frmd4b APN 6 97295944 missense probably benign 0.03
IGL01960:Frmd4b APN 6 97295780 missense possibly damaging 0.93
IGL02408:Frmd4b APN 6 97295809 missense probably damaging 1.00
IGL02429:Frmd4b APN 6 97325429 splice site probably benign
IGL02525:Frmd4b APN 6 97412533 missense probably damaging 1.00
IGL02618:Frmd4b APN 6 97308105 nonsense probably null
IGL03051:Frmd4b APN 6 97295982 nonsense probably null
IGL03120:Frmd4b APN 6 97396245 missense possibly damaging 0.88
IGL03218:Frmd4b APN 6 97308114 missense probably benign 0.01
IGL03260:Frmd4b APN 6 97396224 missense probably damaging 1.00
IGL02984:Frmd4b UTSW 6 97296260 missense probably damaging 0.96
P0031:Frmd4b UTSW 6 97354030 missense probably damaging 1.00
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0058:Frmd4b UTSW 6 97423499 missense probably damaging 1.00
R0255:Frmd4b UTSW 6 97308086 missense probably damaging 1.00
R0437:Frmd4b UTSW 6 97423463 missense probably damaging 1.00
R0594:Frmd4b UTSW 6 97325426 splice site probably benign
R1525:Frmd4b UTSW 6 97296386 missense probably damaging 0.97
R1640:Frmd4b UTSW 6 97308673 missense possibly damaging 0.91
R1768:Frmd4b UTSW 6 97306764 missense possibly damaging 0.68
R1923:Frmd4b UTSW 6 97288454 missense probably benign 0.33
R2056:Frmd4b UTSW 6 97412487 critical splice donor site probably null
R2192:Frmd4b UTSW 6 97487616 missense probably damaging 0.98
R3809:Frmd4b UTSW 6 97323729 missense possibly damaging 0.49
R3831:Frmd4b UTSW 6 97412525 nonsense probably null
R4466:Frmd4b UTSW 6 97323653 critical splice donor site probably null
R4652:Frmd4b UTSW 6 97295755 missense probably benign 0.38
R4679:Frmd4b UTSW 6 97295666 missense possibly damaging 0.94
R4735:Frmd4b UTSW 6 97459259 start gained probably benign
R4793:Frmd4b UTSW 6 97295861 missense probably damaging 0.99
R4940:Frmd4b UTSW 6 97298090 missense probably damaging 1.00
R4948:Frmd4b UTSW 6 97306730 missense probably benign 0.06
R5092:Frmd4b UTSW 6 97295980 missense probably damaging 0.98
R5119:Frmd4b UTSW 6 97300314 missense probably benign 0.03
R5289:Frmd4b UTSW 6 97302348 splice site probably null
R5610:Frmd4b UTSW 6 97306791 missense probably benign
R5690:Frmd4b UTSW 6 97353203 missense possibly damaging 0.56
R6248:Frmd4b UTSW 6 97459212 missense probably benign 0.10
R6437:Frmd4b UTSW 6 97296267 missense probably damaging 1.00
R6459:Frmd4b UTSW 6 97487640 missense probably damaging 1.00
R6825:Frmd4b UTSW 6 97325476 missense possibly damaging 0.89
R6964:Frmd4b UTSW 6 97305197 missense probably damaging 1.00
R7110:Frmd4b UTSW 6 97296231 nonsense probably null
R7154:Frmd4b UTSW 6 97306746 missense probably damaging 1.00
R7764:Frmd4b UTSW 6 97295930 missense probably damaging 1.00
R8073:Frmd4b UTSW 6 97306713 missense probably benign 0.03
X0020:Frmd4b UTSW 6 97305365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGATTGTGTGCAAACCAC -3'
(R):5'- AAACTGATGCGTGTTCTGCG -3'

Sequencing Primer
(F):5'- TAAAACGGCCCAGTGCTTTG -3'
(R):5'- TTCAAGGAAGATTTACTGGTGAGG -3'
Posted On2015-08-18