Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Tln2'

33333

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67370706 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 342 (V342A)

Ref Sequence

ENSEMBL: ENSMUSP00000148901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039662
AA Change: V340A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: V340A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000040025
AA Change: V340A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: V340A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215784
AA Change: V342A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2341

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- AAGGTGAATAATACCCACAGGCTGC -3'
(R):5'- AGCCCCTCCTGCTGAATAATAGTCC -3'

Sequencing Primer
(F):5'- GGCTGCCCTCCAATACC -3'
(R):5'- ACAGCACACCTTTGTGAATCTG -3'

Posted On

2013-05-09