Incidental Mutation 'R4536:Rfx6'
ID 333333
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Name regulatory factor X, 6
Synonyms 4930572O07Rik, Rfxdc1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4536 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 51553856-51606525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51599880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 542 (N542S)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
AlphaFold Q8C7R7
Predicted Effect probably benign
Transcript: ENSMUST00000050455
AA Change: N312S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: N312S

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122922
AA Change: N576S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: N576S

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably benign
Transcript: ENSMUST00000219364
AA Change: N542S

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000219771
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 144,263,138 (GRCm39) S398P probably benign Het
Arhgef17 G C 7: 100,579,061 (GRCm39) S629C probably damaging Het
Atg5lrt G A 10: 95,972,564 (GRCm39) A34T probably benign Het
Atp5if1 A C 4: 132,260,870 (GRCm39) S4A possibly damaging Het
Atp8b2 G A 3: 89,849,091 (GRCm39) A1081V probably benign Het
Atr A G 9: 95,756,471 (GRCm39) D867G probably benign Het
C1qtnf3 G A 15: 10,972,113 (GRCm39) S206N probably damaging Het
Cep152 A C 2: 125,444,867 (GRCm39) probably null Het
Cetn1 T C 18: 9,618,998 (GRCm39) E141G probably damaging Het
Dennd2b A T 7: 109,130,363 (GRCm39) S879R probably damaging Het
Erbb4 A T 1: 68,385,781 (GRCm39) N269K probably damaging Het
Exoc4 C T 6: 33,254,179 (GRCm39) R112C probably damaging Het
Frmd4b T A 6: 97,287,693 (GRCm39) Q241L possibly damaging Het
Fyco1 A G 9: 123,667,953 (GRCm39) V91A probably damaging Het
Gls2 G A 10: 128,036,806 (GRCm39) V196I probably benign Het
Hormad1 T C 3: 95,492,452 (GRCm39) V343A probably benign Het
Incenp T C 19: 9,861,303 (GRCm39) N450S unknown Het
Klhl1 A C 14: 96,374,019 (GRCm39) probably null Het
Mettl4 C A 17: 95,042,933 (GRCm39) S301I possibly damaging Het
Mlxip G A 5: 123,588,566 (GRCm39) D819N probably damaging Het
Or10d5 A T 9: 39,861,731 (GRCm39) L112Q probably damaging Het
Pam T A 1: 97,772,424 (GRCm39) K440* probably null Het
Phldb2 T C 16: 45,591,044 (GRCm39) M996V probably benign Het
Pira13 T A 7: 3,825,251 (GRCm39) M464L probably benign Het
Rad51ap2 A G 12: 11,507,850 (GRCm39) S591G possibly damaging Het
Slc44a4 T A 17: 35,142,815 (GRCm39) C254S probably damaging Het
Sptbn2 C T 19: 4,782,630 (GRCm39) A522V probably damaging Het
Syt10 C T 15: 89,666,825 (GRCm39) D509N probably damaging Het
Tango2 A G 16: 18,142,219 (GRCm39) probably null Het
Tfpi2 T C 6: 3,968,044 (GRCm39) N32S possibly damaging Het
Trafd1 T C 5: 121,517,746 (GRCm39) probably null Het
Ttll2 A T 17: 7,619,120 (GRCm39) I269N probably benign Het
Tysnd1 G A 10: 61,531,832 (GRCm39) W161* probably null Het
Uggt2 A T 14: 119,256,970 (GRCm39) M1088K probably benign Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51,557,982 (GRCm39) missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51,554,501 (GRCm39) missense probably benign 0.16
IGL01639:Rfx6 APN 10 51,592,002 (GRCm39) nonsense probably null
IGL01721:Rfx6 APN 10 51,599,173 (GRCm39) missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51,597,675 (GRCm39) missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51,602,952 (GRCm39) missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51,554,108 (GRCm39) missense probably benign
IGL02479:Rfx6 APN 10 51,554,424 (GRCm39) missense probably benign 0.07
IGL02592:Rfx6 APN 10 51,592,119 (GRCm39) missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51,592,122 (GRCm39) missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51,599,942 (GRCm39) missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51,599,217 (GRCm39) nonsense probably null
IGL03263:Rfx6 APN 10 51,601,903 (GRCm39) missense probably benign 0.00
IGL03373:Rfx6 APN 10 51,596,096 (GRCm39) missense probably damaging 0.99
bulky UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R0060:Rfx6 UTSW 10 51,553,936 (GRCm39) missense probably benign 0.00
R0433:Rfx6 UTSW 10 51,596,124 (GRCm39) missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51,569,833 (GRCm39) missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51,554,498 (GRCm39) missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51,599,221 (GRCm39) critical splice donor site probably null
R2017:Rfx6 UTSW 10 51,597,700 (GRCm39) missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51,596,153 (GRCm39) critical splice donor site probably null
R2044:Rfx6 UTSW 10 51,594,222 (GRCm39) missense probably benign 0.16
R2495:Rfx6 UTSW 10 51,602,771 (GRCm39) splice site probably benign
R2655:Rfx6 UTSW 10 51,569,873 (GRCm39) splice site probably benign
R2912:Rfx6 UTSW 10 51,594,226 (GRCm39) missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51,602,816 (GRCm39) missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51,602,842 (GRCm39) missense probably damaging 1.00
R4791:Rfx6 UTSW 10 51,596,040 (GRCm39) splice site probably null
R4945:Rfx6 UTSW 10 51,602,947 (GRCm39) nonsense probably null
R5223:Rfx6 UTSW 10 51,554,092 (GRCm39) nonsense probably null
R5233:Rfx6 UTSW 10 51,588,187 (GRCm39) nonsense probably null
R5448:Rfx6 UTSW 10 51,559,733 (GRCm39) missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51,599,157 (GRCm39) missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51,602,976 (GRCm39) missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51,601,964 (GRCm39) missense probably benign 0.00
R5949:Rfx6 UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R6001:Rfx6 UTSW 10 51,594,307 (GRCm39) splice site probably null
R6003:Rfx6 UTSW 10 51,584,683 (GRCm39) missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51,587,962 (GRCm39) missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51,601,586 (GRCm39) missense probably benign 0.02
R6876:Rfx6 UTSW 10 51,596,087 (GRCm39) missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51,592,135 (GRCm39) missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51,599,949 (GRCm39) missense probably benign 0.00
R7130:Rfx6 UTSW 10 51,554,476 (GRCm39) nonsense probably null
R7574:Rfx6 UTSW 10 51,557,914 (GRCm39) missense probably benign 0.17
R7845:Rfx6 UTSW 10 51,554,122 (GRCm39) missense probably benign 0.05
R8188:Rfx6 UTSW 10 51,594,292 (GRCm39) missense probably benign 0.05
R8338:Rfx6 UTSW 10 51,594,190 (GRCm39) missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51,601,501 (GRCm39) missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51,557,968 (GRCm39) missense probably damaging 1.00
R8982:Rfx6 UTSW 10 51,599,915 (GRCm39) missense probably benign 0.14
R9104:Rfx6 UTSW 10 51,599,106 (GRCm39) missense probably damaging 1.00
R9154:Rfx6 UTSW 10 51,597,600 (GRCm39) missense probably benign 0.01
R9188:Rfx6 UTSW 10 51,594,263 (GRCm39) missense probably benign 0.04
R9388:Rfx6 UTSW 10 51,554,117 (GRCm39) missense possibly damaging 0.60
V8831:Rfx6 UTSW 10 51,594,304 (GRCm39) critical splice donor site probably null
X0023:Rfx6 UTSW 10 51,554,507 (GRCm39) missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51,601,927 (GRCm39) nonsense probably null
Z1176:Rfx6 UTSW 10 51,594,189 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCACCAAAGCCTGTTTCCTATG -3'
(R):5'- ACTGTGCTGGAAAGTCTGTTAAG -3'

Sequencing Primer
(F):5'- GGAAAATATTATGCAGGAGTTTCCAG -3'
(R):5'- AAGGTGGTCTTTATTGATTCTCCAC -3'
Posted On 2015-08-18