Incidental Mutation 'R4536:Gls2'
ID333336
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Nameglutaminase 2 (liver, mitochondrial)
SynonymsLga, A330074B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128194457-128210004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128200937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 196 (V196I)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000123291] [ENSMUST00000143827] [ENSMUST00000159440]
Predicted Effect probably benign
Transcript: ENSMUST00000044776
AA Change: V196I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: V196I

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123385
Predicted Effect probably benign
Transcript: ENSMUST00000134104
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect silent
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152928
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128200971 unclassified probably null
IGL00583:Gls2 APN 10 128204882 missense probably benign 0.11
IGL01444:Gls2 APN 10 128201347 missense probably damaging 1.00
IGL02746:Gls2 APN 10 128200956 missense probably damaging 1.00
R0015:Gls2 UTSW 10 128209350 missense probably damaging 1.00
R0024:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R0378:Gls2 UTSW 10 128207311 missense probably benign
R1179:Gls2 UTSW 10 128199234 missense probably damaging 1.00
R1227:Gls2 UTSW 10 128199664 missense probably damaging 1.00
R1421:Gls2 UTSW 10 128201348 nonsense probably null
R1750:Gls2 UTSW 10 128201325 missense probably damaging 1.00
R1952:Gls2 UTSW 10 128209362 missense probably benign
R2218:Gls2 UTSW 10 128204714 missense probably damaging 1.00
R2291:Gls2 UTSW 10 128207610 nonsense probably null
R2382:Gls2 UTSW 10 128203842 missense probably damaging 1.00
R5305:Gls2 UTSW 10 128204709 nonsense probably null
R5435:Gls2 UTSW 10 128195126 intron probably benign
R5767:Gls2 UTSW 10 128205221 missense probably damaging 1.00
R7223:Gls2 UTSW 10 128199194 missense probably benign
R7767:Gls2 UTSW 10 128195129 missense unknown
R8068:Gls2 UTSW 10 128195114 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTAAAGGCCTTGTTGGTTCTG -3'
(R):5'- AGGGGCTAGACTTTGTTCCTC -3'

Sequencing Primer
(F):5'- CCTTGTTGGTTCTGGAAGGAATATAC -3'
(R):5'- ACCCAGCATCTTTGTTTTGAGACAG -3'
Posted On2015-08-18