Incidental Mutation 'R4536:Rad51ap2'
ID333337
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11457849 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 591 (S591G)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124065
AA Change: S591G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: S591G

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R8040:Rad51ap2 UTSW 12 11458791 missense probably benign 0.03
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCTTTAATGGGTTTTGATAACACGG -3'
(R):5'- GTTTCACTTAACAGATTCTCCAAGC -3'

Sequencing Primer
(F):5'- GGTTTTGATAACACGGAAGAACTTTC -3'
(R):5'- CTTCAGAGTTATCGCCATAG -3'
Posted On2015-08-18