Incidental Mutation 'R4536:Uggt2'
ID333341
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119019558 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1088 (M1088K)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153693
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156203
AA Change: M1088K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: M1088K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173391
SMART Domains Protein: ENSMUSP00000133772
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 2 63 9.4e-18 PFAM
SCOP:d1ga8a_ 77 216 3e-21 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
R7842:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R7925:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7974:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R8050:Uggt2 UTSW 14 119026422 missense probably damaging 0.98
Z1177:Uggt2 UTSW 14 119007296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTAGAGAGGAGTTTATCTTCAC -3'
(R):5'- AAAATTGGTGGTTGGATCAGTTCAC -3'

Sequencing Primer
(F):5'- GGCCATCACTATTGTGTCAA -3'
(R):5'- TGGATCAGTTCACTTATGTGTTTAAG -3'
Posted On2015-08-18