Incidental Mutation 'R4536:Syt10'
ID333343
Institutional Source Beutler Lab
Gene Symbol Syt10
Ensembl Gene ENSMUSG00000063260
Gene Namesynaptotagmin X
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89782393-89841860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89782622 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 509 (D509N)
Ref Sequence ENSEMBL: ENSMUSP00000029441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029441]
Predicted Effect probably damaging
Transcript: ENSMUST00000029441
AA Change: D509N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029441
Gene: ENSMUSG00000063260
AA Change: D509N

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
C2 247 350 1.22e-19 SMART
C2 379 493 7.73e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit minor circadian rhythm impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Syt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Syt10 APN 15 89814079 missense probably damaging 1.00
IGL02976:Syt10 APN 15 89814479 missense probably benign 0.26
R0200:Syt10 UTSW 15 89826941 missense probably benign 0.01
R0306:Syt10 UTSW 15 89826988 missense probably benign 0.02
R0580:Syt10 UTSW 15 89827176 missense probably benign 0.15
R0608:Syt10 UTSW 15 89826941 missense probably benign 0.01
R1705:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1706:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1921:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1922:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2072:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2074:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2119:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2120:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2121:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R3812:Syt10 UTSW 15 89790797 missense probably benign
R4029:Syt10 UTSW 15 89814538 missense probably benign
R4270:Syt10 UTSW 15 89790892 missense probably benign 0.39
R5333:Syt10 UTSW 15 89841729 missense probably benign 0.00
R6042:Syt10 UTSW 15 89841621 missense probably benign 0.13
R6104:Syt10 UTSW 15 89826864 missense probably benign 0.02
R6445:Syt10 UTSW 15 89814268 missense probably damaging 1.00
R6470:Syt10 UTSW 15 89792601 missense probably damaging 1.00
R6472:Syt10 UTSW 15 89814558 missense probably benign
R6679:Syt10 UTSW 15 89814371 missense probably damaging 1.00
R7048:Syt10 UTSW 15 89790805 missense probably damaging 1.00
R7128:Syt10 UTSW 15 89814111 missense probably damaging 1.00
R7315:Syt10 UTSW 15 89814338 missense probably damaging 0.99
R7352:Syt10 UTSW 15 89814456 missense probably benign 0.42
R7686:Syt10 UTSW 15 89814157 missense probably damaging 1.00
R7789:Syt10 UTSW 15 89826898 missense probably damaging 1.00
X0057:Syt10 UTSW 15 89826928 missense probably damaging 1.00
Z1088:Syt10 UTSW 15 89841639 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAAGGGCCATTAGTACTCAAGTAG -3'
(R):5'- CCTTGGAAGGTAAGTTCTGATGAAC -3'

Sequencing Primer
(F):5'- TGCTCAAAGTTGAAGACAAATAAGCC -3'
(R):5'- ACATGGAGGTTACATAGATCATCAC -3'
Posted On2015-08-18