Incidental Mutation 'R4536:Mettl4'
ID333348
Institutional Source Beutler Lab
Gene Symbol Mettl4
Ensembl Gene ENSMUSG00000055660
Gene Namemethyltransferase like 4
SynonymsHsT661, A730091E08Rik, 2410198H06Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location94727080-94749892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94735505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 301 (S301I)
Ref Sequence ENSEMBL: ENSMUSP00000127142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171284]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171284
AA Change: S301I

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127142
Gene: ENSMUSG00000055660
AA Change: S301I

DomainStartEndE-ValueType
Pfam:MT-A70 280 454 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Mettl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Mettl4 APN 17 94735371 missense probably damaging 1.00
R1938:Mettl4 UTSW 17 94747857 missense possibly damaging 0.76
R2172:Mettl4 UTSW 17 94733163 missense probably benign
R2370:Mettl4 UTSW 17 94733148 missense probably damaging 1.00
R3621:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
R3913:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R4155:Mettl4 UTSW 17 94740575 missense probably benign
R4946:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R5263:Mettl4 UTSW 17 94740509 nonsense probably null
R5397:Mettl4 UTSW 17 94727277 nonsense probably null
R6242:Mettl4 UTSW 17 94735374 missense probably damaging 1.00
R6508:Mettl4 UTSW 17 94743945 missense probably damaging 0.98
R7069:Mettl4 UTSW 17 94733633 missense probably damaging 0.98
R8088:Mettl4 UTSW 17 94735367 missense probably damaging 1.00
R8373:Mettl4 UTSW 17 94733649 missense probably damaging 1.00
Z1176:Mettl4 UTSW 17 94733563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCCTGGAAGTGAAAAGTGATGC -3'
(R):5'- TTGGTACATGTGTAAGTGCCAG -3'

Sequencing Primer
(F):5'- TGCTGAGATAACAGACAAGCTAAC -3'
(R):5'- GGCTCCTAGACCTTTGTA -3'
Posted On2015-08-18