Mutagenetix > Incidental Mutation

Incidental Mutation 'R4537:Mrpl24'

333360

Institutional Source

Beutler Lab

Gene Symbol

Mrpl24

Ensembl Gene

ENSMUSG00000019710

Gene Name

mitochondrial ribosomal protein L24

Synonyms

6720473G22Rik, 2810470K06Rik, 2010005E08Rik

MMRRC Submission

041774-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R4537 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87826813-87830979 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 87829719 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 102 (K102Q)

Ref Sequence

ENSEMBL: ENSMUSP00000112885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000019854] [ENSMUST00000119968] [ENSMUST00000121048] [ENSMUST00000121920] [ENSMUST00000137775] [ENSMUST00000160143] [ENSMUST00000160648] [ENSMUST00000164439] [ENSMUST00000160074]

AlphaFold

Q9CQ06

Predicted Effect

probably benign
Transcript: ENSMUST00000005016

SMART Domains

Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_32	133	293	1.5e-29	PFAM
low complexity region	385	402	N/A	INTRINSIC
low complexity region	412	426	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000019854
AA Change: K102Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000019854
Gene: ENSMUSG00000019710
AA Change: K102Q

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
KOW	55	82	7.17e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119968
AA Change: K102Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114111
Gene: ENSMUSG00000019710
AA Change: K102Q

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
KOW	55	82	7.17e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121048
AA Change: K102Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000113959
Gene: ENSMUSG00000019710
AA Change: K102Q

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
KOW	55	82	7.17e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121920
AA Change: K102Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112885
Gene: ENSMUSG00000019710
AA Change: K102Q

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
KOW	55	82	7.17e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137775

SMART Domains

Protein: ENSMUSP00000142071
Gene: ENSMUSG00000019710

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
PDB:4CE4\|Y	17	62	5e-21	PDB
SCOP:d1jj2s_	24	54	2e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152287

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159091

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168070

Predicted Effect

probably benign
Transcript: ENSMUST00000160143

SMART Domains

Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_32	133	247	5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160648

Predicted Effect

probably benign
Transcript: ENSMUST00000164439

Predicted Effect

probably benign
Transcript: ENSMUST00000160074

SMART Domains

Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_32	69	229	1.3e-29	PFAM
low complexity region	321	338	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which is more than twice the size of its E.coli counterpart (EcoL24). Sequence analysis identified two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4b	T	A	13: 14,294,746 (GRCm39)	Y9*	probably null	Het
Aspm	T	C	1: 139,402,041 (GRCm39)	I1235T	probably benign	Het
Defb30	T	C	14: 63,273,525 (GRCm39)	I29M	probably damaging	Het
Dnajc13	CT	C	9: 104,064,004 (GRCm39)		probably benign	Het
Dpy19l3	T	C	7: 35,411,326 (GRCm39)	T428A	probably benign	Het
Fam83b	T	C	9: 76,399,424 (GRCm39)	T560A	probably benign	Het
Fnip2	A	G	3: 79,373,021 (GRCm39)	V1019A	probably damaging	Het
Fus	A	G	7: 127,575,087 (GRCm39)	D268G	probably damaging	Het
Gm14412	T	A	2: 177,006,352 (GRCm39)	K514N	probably benign	Het
Gphn	T	C	12: 78,540,788 (GRCm39)	L265P	probably benign	Het
Grm3	A	G	5: 9,562,083 (GRCm39)	M589T	probably benign	Het
Hoxa1	G	T	6: 52,134,973 (GRCm39)	Q77K	probably benign	Het
Ighv14-2	A	G	12: 113,958,512 (GRCm39)	C3R	probably benign	Het
Itgb2	G	A	10: 77,397,050 (GRCm39)		probably null	Het
Ogfod2	C	T	5: 124,252,591 (GRCm39)		probably benign	Het
Olig2	A	G	16: 91,023,732 (GRCm39)	I149V	probably damaging	Het
Or10g9	T	A	9: 39,911,616 (GRCm39)	K302N	probably benign	Het
Or56a3b	T	A	7: 104,776,227 (GRCm39)	I84F	probably damaging	Het
Or7g19	T	A	9: 18,856,526 (GRCm39)	I194N	possibly damaging	Het
Oxr1	A	G	15: 41,683,915 (GRCm39)	Q515R	possibly damaging	Het
Rae1	G	T	2: 172,857,185 (GRCm39)		probably benign	Het
Slc25a12	T	A	2: 71,105,450 (GRCm39)		probably benign	Het
Slc2a3	C	A	6: 122,714,063 (GRCm39)	G157V	probably damaging	Het
Slc5a4a	C	T	10: 76,013,929 (GRCm39)	R379*	probably null	Het
Sost	G	A	11: 101,857,670 (GRCm39)	P44S	probably damaging	Het
Sprr2f	A	T	3: 92,273,366 (GRCm39)	Q55L	unknown	Het
Srd5a3	G	A	5: 76,297,798 (GRCm39)		probably null	Het
Tmtc1	C	T	6: 148,164,280 (GRCm39)		probably null	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,105,278 (GRCm39)		probably benign	Het
Ulk4	G	A	9: 121,092,704 (GRCm39)	R178*	probably null	Het
Uspl1	A	G	5: 149,124,588 (GRCm39)	T2A	possibly damaging	Het
Vmn2r87	T	G	10: 130,308,054 (GRCm39)	H728P	probably benign	Het
Vmn2r93	T	A	17: 18,525,194 (GRCm39)	M284K	possibly damaging	Het
Zfp101	T	A	17: 33,601,466 (GRCm39)	M59L	possibly damaging	Het
Zfp558	T	C	9: 18,368,798 (GRCm39)	E146G	probably null	Het

Other mutations in Mrpl24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Mrpl24	APN	3	87,829,526 (GRCm39)	nonsense	probably null
R1466:Mrpl24	UTSW	3	87,829,235 (GRCm39)	nonsense	probably null
R1466:Mrpl24	UTSW	3	87,829,235 (GRCm39)	nonsense	probably null
R1467:Mrpl24	UTSW	3	87,829,744 (GRCm39)	missense	probably benign	0.00
R1467:Mrpl24	UTSW	3	87,829,744 (GRCm39)	missense	probably benign	0.00
R2070:Mrpl24	UTSW	3	87,830,374 (GRCm39)	critical splice donor site	probably null
R2071:Mrpl24	UTSW	3	87,830,374 (GRCm39)	critical splice donor site	probably null
R4628:Mrpl24	UTSW	3	87,829,436 (GRCm39)	splice site	probably null
R4785:Mrpl24	UTSW	3	87,829,357 (GRCm39)	critical splice donor site	probably null
R5841:Mrpl24	UTSW	3	87,830,292 (GRCm39)	missense	probably damaging	1.00
R6007:Mrpl24	UTSW	3	87,829,705 (GRCm39)	missense	probably benign	0.02
R7513:Mrpl24	UTSW	3	87,829,734 (GRCm39)	missense	probably benign	0.07
R8826:Mrpl24	UTSW	3	87,829,701 (GRCm39)	nonsense	probably null
X0064:Mrpl24	UTSW	3	87,829,735 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCGAAACTGGGTTGTCCTG -3'
(R):5'- GACCTCTGAGTTCCATCATATTCAAC -3'

Sequencing Primer
(F):5'- AACACGGTGAGTCTTGAGAAGTCTTC -3'
(R):5'- TCAACACATTAGTCTGATGTACCC -3'

Posted On

2015-08-18