Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Mthfd1l'

33337

Institutional Source

Beutler Lab

Gene Symbol

Mthfd1l

Ensembl Gene

ENSMUSG00000040675

Gene Name

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like

Synonyms

Fthfsdc1, 2410004L15Rik

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3973118-4167081 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4041838 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 597 (Y597H)

Ref Sequence

ENSEMBL: ENSMUSP00000112897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]

Predicted Effect

probably benign
Transcript: ENSMUST00000043735
AA Change: Y597H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: Y597H

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	71	179	2.9e-15	PFAM
Pfam:THF_DHG_CYH_C	182	337	1.1e-27	PFAM
Pfam:FTHFS	358	977	1.2e-260	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117291
AA Change: Y597H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: Y597H

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	71	179	2.9e-15	PFAM
Pfam:THF_DHG_CYH_C	182	337	1.1e-27	PFAM
Pfam:FTHFS	358	977	1.2e-260	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120585
AA Change: Y597H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: Y597H

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	70	179	8e-17	PFAM
Pfam:THF_DHG_CYH_C	182	337	5.4e-28	PFAM
Pfam:FTHFS	359	977	7.2e-260	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154517

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Mthfd1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Mthfd1l	APN	10	3989971	synonymous	probably benign
IGL01013:Mthfd1l	APN	10	4030716	missense	probably damaging	1.00
IGL01018:Mthfd1l	APN	10	3978708	missense	probably benign
IGL01018:Mthfd1l	APN	10	4007800	missense	probably benign
IGL01018:Mthfd1l	APN	10	4032345	splice site	probably benign
IGL01068:Mthfd1l	APN	10	4028428	missense	probably damaging	1.00
IGL01584:Mthfd1l	APN	10	4016738	missense	probably damaging	0.97
IGL01609:Mthfd1l	APN	10	4018567	missense	probably benign	0.00
IGL02272:Mthfd1l	APN	10	4041812	missense	probably damaging	0.99
IGL02344:Mthfd1l	APN	10	4048272	splice site	probably null
IGL02429:Mthfd1l	APN	10	4089334	missense	probably damaging	1.00
IGL02503:Mthfd1l	APN	10	4083824	missense	probably damaging	1.00
IGL02748:Mthfd1l	APN	10	4018587	missense	possibly damaging	0.94
IGL02748:Mthfd1l	APN	10	3980268	critical splice donor site	probably null
IGL03031:Mthfd1l	APN	10	4018601	critical splice donor site	probably null
IGL03047:Mthfd1l	APN	10	3980409	splice site	probably benign
IGL03215:Mthfd1l	APN	10	4041826	missense	probably benign	0.14
IGL03367:Mthfd1l	APN	10	4106536	splice site	probably benign
R0047:Mthfd1l	UTSW	10	3978727	splice site	probably benign
R0047:Mthfd1l	UTSW	10	3978727	splice site	probably benign
R0348:Mthfd1l	UTSW	10	4056766	missense	probably damaging	1.00
R0496:Mthfd1l	UTSW	10	4090006	missense	probably benign
R0658:Mthfd1l	UTSW	10	4047976	splice site	probably null
R1177:Mthfd1l	UTSW	10	3985661	missense	possibly damaging	0.82
R1676:Mthfd1l	UTSW	10	4083877	critical splice donor site	probably null
R1703:Mthfd1l	UTSW	10	4148093	missense	probably damaging	1.00
R1888:Mthfd1l	UTSW	10	4106528	missense	probably damaging	1.00
R1888:Mthfd1l	UTSW	10	4106528	missense	probably damaging	1.00
R1891:Mthfd1l	UTSW	10	4032284	nonsense	probably null
R2014:Mthfd1l	UTSW	10	4047894	missense	probably benign
R2061:Mthfd1l	UTSW	10	4103288	missense	probably benign	0.00
R2197:Mthfd1l	UTSW	10	4028399	missense	probably damaging	1.00
R2360:Mthfd1l	UTSW	10	4056771	missense	probably damaging	1.00
R3085:Mthfd1l	UTSW	10	4090007	missense	probably benign	0.00
R3176:Mthfd1l	UTSW	10	4148025	missense	probably damaging	1.00
R3276:Mthfd1l	UTSW	10	4148025	missense	probably damaging	1.00
R4065:Mthfd1l	UTSW	10	4032242	missense	probably damaging	1.00
R4612:Mthfd1l	UTSW	10	4030717	missense	probably damaging	1.00
R4803:Mthfd1l	UTSW	10	4007840	missense	possibly damaging	0.52
R4883:Mthfd1l	UTSW	10	4007775	missense	probably benign	0.11
R4932:Mthfd1l	UTSW	10	3980241	missense	probably benign	0.00
R5507:Mthfd1l	UTSW	10	4106432	missense	probably benign	0.20
R5687:Mthfd1l	UTSW	10	3990002	splice site	probably null
R5694:Mthfd1l	UTSW	10	4035239	missense	possibly damaging	0.90
R5727:Mthfd1l	UTSW	10	4103302	missense	possibly damaging	0.86
R5908:Mthfd1l	UTSW	10	4089392	missense	probably damaging	1.00
R5951:Mthfd1l	UTSW	10	4048222	missense	probably damaging	1.00
R6330:Mthfd1l	UTSW	10	3980234	missense	probably benign
R6583:Mthfd1l	UTSW	10	4047937	missense	probably damaging	0.96
R6846:Mthfd1l	UTSW	10	4047898	missense	probably damaging	1.00
R7105:Mthfd1l	UTSW	10	4103261	missense	probably benign
R7456:Mthfd1l	UTSW	10	4089998	missense	probably damaging	1.00
R7848:Mthfd1l	UTSW	10	4083739	missense	possibly damaging	0.81
R8003:Mthfd1l	UTSW	10	3984147	missense	probably benign	0.00
R8073:Mthfd1l	UTSW	10	3973417	missense	probably benign	0.28
R8140:Mthfd1l	UTSW	10	4007745	nonsense	probably null
R8478:Mthfd1l	UTSW	10	4148064	missense	probably damaging	1.00
X0003:Mthfd1l	UTSW	10	4089303	missense	probably damaging	0.99
Z1088:Mthfd1l	UTSW	10	4007844	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCAGCAGTCACCATGTTAACCATC -3'
(R):5'- ACTCTCCCAAGTCCTAGCTCATCAG -3'

Sequencing Primer
(F):5'- TCCATAGCCGTACAACTGATAG -3'
(R):5'- GTCCTAGCTCATCAGAGCAG -3'

Posted On

2013-05-09