Incidental Mutation 'R4537:Olfr681'
ID333373
Institutional Source Beutler Lab
Gene Symbol Olfr681
Ensembl Gene ENSMUSG00000095248
Gene Nameolfactory receptor 681
SynonymsMOR40-14, GA_x6K02T2PBJ9-7750163-7751110
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105116836-105125523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105127020 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 84 (I84F)
Ref Sequence ENSEMBL: ENSMUSP00000154052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071242] [ENSMUST00000098157] [ENSMUST00000214399] [ENSMUST00000215517] [ENSMUST00000215564] [ENSMUST00000216247]
Predicted Effect probably damaging
Transcript: ENSMUST00000071242
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071223
Gene: ENSMUSG00000059768
AA Change: I94F

DomainStartEndE-ValueType
Pfam:7tm_4 23 299 1.2e-71 PFAM
Pfam:7TM_GPCR_Srsx 27 297 3.9e-10 PFAM
Pfam:7tm_1 33 283 3.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071242
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000098157
SMART Domains Protein: ENSMUSP00000095760
Gene: ENSMUSG00000095248

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2e-72 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.1e-10 PFAM
Pfam:7tm_1 45 296 7.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214399
AA Change: I84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215180
Predicted Effect probably benign
Transcript: ENSMUST00000215517
Predicted Effect probably benign
Transcript: ENSMUST00000215564
Predicted Effect probably benign
Transcript: ENSMUST00000216247
Meta Mutation Damage Score 0.1628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Olfr681
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Olfr681 APN 7 105122407 unclassified probably null
IGL01664:Olfr681 APN 7 105122216 missense probably damaging 1.00
IGL02691:Olfr681 APN 7 105122131 missense probably damaging 1.00
IGL02839:Olfr681 APN 7 105122356 missense probably damaging 1.00
R0533:Olfr681 UTSW 7 105122350 missense probably benign 0.11
R1139:Olfr681 UTSW 7 105121973 missense probably damaging 1.00
R1857:Olfr681 UTSW 7 105121544 missense probably benign 0.00
R4153:Olfr681 UTSW 7 105122309 missense probably damaging 0.99
R4391:Olfr681 UTSW 7 105121586 missense possibly damaging 0.60
R4671:Olfr681 UTSW 7 105122306 missense probably damaging 1.00
R4789:Olfr681 UTSW 7 105122313 missense probably null 0.07
R5215:Olfr681 UTSW 7 105126564 missense probably damaging 1.00
R6080:Olfr681 UTSW 7 105121909 missense probably benign 0.19
R6194:Olfr681 UTSW 7 105122170 missense probably benign 0.07
R7054:Olfr681 UTSW 7 105121963 nonsense probably null
R7186:Olfr681 UTSW 7 105122266 missense probably benign 0.12
R7528:Olfr681 UTSW 7 105121864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCTAGAAGATTGCGGGC -3'
(R):5'- GCTTGGTCTCTAGACTTAAAGAAAAGG -3'

Sequencing Primer
(F):5'- TTGCGGGCAACAATAAAAATGGC -3'
(R):5'- CCTATCACGAGGGTTGCATATCAG -3'
Posted On2015-08-18