Mutagenetix > Incidental Mutations

Incidental Mutation 'R4537:Olfr681'

333373

Institutional Source

Beutler Lab

Gene Symbol

Olfr681

Ensembl Gene

ENSMUSG00000095248

Gene Name

olfactory receptor 681

Synonyms

MOR40-14, GA_x6K02T2PBJ9-7750163-7751110

MMRRC Submission

041774-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R4537 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105116836-105125523 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105127020 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 84 (I84F)

Ref Sequence

ENSEMBL: ENSMUSP00000154052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071242] [ENSMUST00000098157] [ENSMUST00000214399] [ENSMUST00000215517] [ENSMUST00000215564] [ENSMUST00000216247]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071242
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071223
Gene: ENSMUSG00000059768
AA Change: I94F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	23	299	1.2e-71	PFAM
Pfam:7TM_GPCR_Srsx	27	297	3.9e-10	PFAM
Pfam:7tm_1	33	283	3.4e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000071242
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000098157

SMART Domains

Protein: ENSMUSP00000095760
Gene: ENSMUSG00000095248

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	313	2e-72	PFAM
Pfam:7TM_GPCR_Srsx	39	311	6.1e-10	PFAM
Pfam:7tm_1	45	296	7.6e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214399
AA Change: I84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215180

Predicted Effect

probably benign
Transcript: ENSMUST00000215517

Predicted Effect

probably benign
Transcript: ENSMUST00000215564

Predicted Effect

probably benign
Transcript: ENSMUST00000216247

Meta Mutation Damage Score

0.1628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4b	T	A	13: 14,120,161	Y9*	probably null	Het
Aspm	T	C	1: 139,474,303	I1235T	probably benign	Het
Defb30	T	C	14: 63,036,076	I29M	probably damaging	Het
Dnajc13	CT	C	9: 104,186,805		probably benign	Het
Dpy19l3	T	C	7: 35,711,901	T428A	probably benign	Het
Fam83b	T	C	9: 76,492,142	T560A	probably benign	Het
Fnip2	A	G	3: 79,465,714	V1019A	probably damaging	Het
Fus	A	G	7: 127,975,915	D268G	probably damaging	Het
Gm14412	T	A	2: 177,314,559	K514N	probably benign	Het
Gphn	T	C	12: 78,494,014	L265P	probably benign	Het
Grm3	A	G	5: 9,512,083	M589T	probably benign	Het
Hoxa1	G	T	6: 52,157,993	Q77K	probably benign	Het
Ighv14-2	A	G	12: 113,994,892	C3R	probably benign	Het
Itgb2	G	A	10: 77,561,216		probably null	Het
Mrpl24	A	C	3: 87,922,412	K102Q	probably benign	Het
Ogfod2	C	T	5: 124,114,528		probably benign	Het
Olfr832	T	A	9: 18,945,230	I194N	possibly damaging	Het
Olfr979	T	A	9: 40,000,320	K302N	probably benign	Het
Olig2	A	G	16: 91,226,844	I149V	probably damaging	Het
Oxr1	A	G	15: 41,820,519	Q515R	possibly damaging	Het
Rae1	G	T	2: 173,015,392		probably benign	Het
Slc25a12	T	A	2: 71,275,106		probably benign	Het
Slc2a3	C	A	6: 122,737,104	G157V	probably damaging	Het
Slc5a4a	C	T	10: 76,178,095	R379*	probably null	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sprr2f	A	T	3: 92,366,059	Q55L	unknown	Het
Srd5a3	G	A	5: 76,149,951		probably null	Het
Tmtc1	C	T	6: 148,262,782		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Ulk4	G	A	9: 121,263,638	R178*	probably null	Het
Uspl1	A	G	5: 149,187,778	T2A	possibly damaging	Het
Vmn2r87	T	G	10: 130,472,185	H728P	probably benign	Het
Vmn2r93	T	A	17: 18,304,932	M284K	possibly damaging	Het
Zfp101	T	A	17: 33,382,492	M59L	possibly damaging	Het
Zfp558	T	C	9: 18,457,502	E146G	probably null	Het

Other mutations in Olfr681

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Olfr681	APN	7	105122407	unclassified	probably null
IGL01664:Olfr681	APN	7	105122216	missense	probably damaging	1.00
IGL02691:Olfr681	APN	7	105122131	missense	probably damaging	1.00
IGL02839:Olfr681	APN	7	105122356	missense	probably damaging	1.00
R0533:Olfr681	UTSW	7	105122350	missense	probably benign	0.11
R1139:Olfr681	UTSW	7	105121973	missense	probably damaging	1.00
R1857:Olfr681	UTSW	7	105121544	missense	probably benign	0.00
R4153:Olfr681	UTSW	7	105122309	missense	probably damaging	0.99
R4391:Olfr681	UTSW	7	105121586	missense	possibly damaging	0.60
R4671:Olfr681	UTSW	7	105122306	missense	probably damaging	1.00
R4789:Olfr681	UTSW	7	105122313	missense	probably null	0.07
R5215:Olfr681	UTSW	7	105126564	missense	probably damaging	1.00
R6080:Olfr681	UTSW	7	105121909	missense	probably benign	0.19
R6194:Olfr681	UTSW	7	105122170	missense	probably benign	0.07
R7054:Olfr681	UTSW	7	105121963	nonsense	probably null
R7186:Olfr681	UTSW	7	105122266	missense	probably benign	0.12
R7528:Olfr681	UTSW	7	105121864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGCTAGAAGATTGCGGGC -3'
(R):5'- GCTTGGTCTCTAGACTTAAAGAAAAGG -3'

Sequencing Primer
(F):5'- TTGCGGGCAACAATAAAAATGGC -3'
(R):5'- CCTATCACGAGGGTTGCATATCAG -3'

Posted On

2015-08-18