Incidental Mutation 'R4537:Ulk4'
ID333381
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 041774-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121263638 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 178 (R178*)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably null
Transcript: ENSMUST00000051479
AA Change: R178*
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably null
Transcript: ENSMUST00000171061
AA Change: R178*
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
AA Change: R178*
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATTGTCCAAGAC -3'
(R):5'- CTTCTGAGCCGTGACAGAAC -3'

Sequencing Primer
(F):5'- CAAGACCTCTTGTGCTGACAC -3'
(R):5'- CCCTGTGAGGCCTGAATTG -3'
Posted On2015-08-18