Incidental Mutation 'R4537:Ighv14-2'
ID333389
Institutional Source Beutler Lab
Gene Symbol Ighv14-2
Ensembl Gene ENSMUSG00000095583
Gene Nameimmunoglobulin heavy variable 14-2
SynonymsGm16683
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113994469-113994898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113994892 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 3 (C3R)
Ref Sequence ENSEMBL: ENSMUSP00000100248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103467]
Predicted Effect probably benign
Transcript: ENSMUST00000103467
AA Change: C3R

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100248
Gene: ENSMUSG00000095583
AA Change: C3R

DomainStartEndE-ValueType
IGv 36 117 5.95e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Ighv14-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ighv14-2 APN 12 113994759 missense possibly damaging 0.47
IGL01685:Ighv14-2 APN 12 113994501 missense probably damaging 0.99
IGL02994:Ighv14-2 APN 12 113994591 missense probably benign 0.10
IGL03222:Ighv14-2 APN 12 113994494 missense possibly damaging 0.94
R6004:Ighv14-2 UTSW 12 113994635 missense probably damaging 0.98
R6294:Ighv14-2 UTSW 12 113994598 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTGCAGGACAACTTGACTGAG -3'
(R):5'- CAGCATCCTGTTGACTGACC -3'

Sequencing Primer
(F):5'- ACAACTTGACTGAGGCCCCTG -3'
(R):5'- ATCCTGTTGACTGACCCAGGTG -3'
Posted On2015-08-18