Incidental Mutation 'R4537:Olig2'
ID333394
Institutional Source Beutler Lab
Gene Symbol Olig2
Ensembl Gene ENSMUSG00000039830
Gene Nameoligodendrocyte transcription factor 2
SynonymsBhlhb1, bHLHe19, RK17, Olg-2
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4537 (G1)
Quality Score164
Status Validated
Chromosome16
Chromosomal Location91225457-91228677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91226844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 149 (I149V)
Ref Sequence ENSEMBL: ENSMUSP00000036797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035608]
Predicted Effect probably damaging
Transcript: ENSMUST00000035608
AA Change: I149V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036797
Gene: ENSMUSG00000039830
AA Change: I149V

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
HLH 114 168 5.28e-14 SMART
low complexity region 192 254 N/A INTRINSIC
low complexity region 259 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231709
Meta Mutation Damage Score 0.1151 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, impaired development of motoneurons and oligodendrocytes, aphagia, hypotonia, and abnormal posture and breathing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Olig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02322:Olig2 APN 16 91226658 missense probably benign 0.04
R2367:Olig2 UTSW 16 91226566 missense possibly damaging 0.84
R5597:Olig2 UTSW 16 91226880 missense probably benign 0.11
R6612:Olig2 UTSW 16 91226881 missense probably damaging 0.99
R6626:Olig2 UTSW 16 91227156 missense unknown
R7081:Olig2 UTSW 16 91226419 missense probably damaging 0.97
R7352:Olig2 UTSW 16 91226689 missense probably benign 0.08
R7738:Olig2 UTSW 16 91227160 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCATCTTCCTCCAGCAC -3'
(R):5'- ATGGATCCGACCGAGGACAG -3'

Sequencing Primer
(F):5'- AGCACCTCCTCGTCCACG -3'
(R):5'- TAGAGAGGCGCTGGACACC -3'
Posted On2015-08-18