Incidental Mutation 'R4538:Cope'
ID333414
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
MMRRC Submission 041775-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4538 (G1)
Quality Score184
Status Validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70306507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 16 (I16N)
Ref Sequence ENSEMBL: ENSMUSP00000122888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008004] [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000150968] [ENSMUST00000168018]
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066469
AA Change: I100N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127076
Predicted Effect probably damaging
Transcript: ENSMUST00000128003
AA Change: I16N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681
AA Change: I16N

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect probably damaging
Transcript: ENSMUST00000150968
AA Change: I100N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167850
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168018
AA Change: H66Q

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681
AA Change: H66Q

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,488,837 V61M unknown Het
Abcc9 A G 6: 142,614,412 probably null Het
Adcy10 A T 1: 165,513,127 M234L probably benign Het
B4galt3 T C 1: 171,272,710 F150S probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Chd4 A T 6: 125,120,686 D1377V probably damaging Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cyp7b1 A T 3: 18,097,581 I156N possibly damaging Het
Depdc5 T C 5: 32,983,946 Y1397H probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Ebf1 T A 11: 44,907,995 D289E probably benign Het
Egflam T C 15: 7,252,437 Y406C probably damaging Het
Hfm1 T C 5: 106,874,890 T949A possibly damaging Het
Ifih1 A G 2: 62,617,412 V316A probably damaging Het
Kif1a C T 1: 93,077,047 V142M probably damaging Het
Kng2 C A 16: 22,988,063 R462L probably benign Het
Lrrn1 T A 6: 107,568,637 N465K probably benign Het
Mdn1 T A 4: 32,722,334 L2372Q probably damaging Het
Men1 T C 19: 6,336,754 F159L possibly damaging Het
Mul1 T C 4: 138,438,395 probably benign Het
Olfr168 A T 16: 19,530,631 C96* probably null Het
Pramel6 T G 2: 87,508,559 H34Q probably benign Het
Ripk4 A T 16: 97,743,152 L702* probably null Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Slc9a3 T C 13: 74,161,732 V513A possibly damaging Het
Strada A C 11: 106,167,825 M245R probably damaging Het
Sycp1 A T 3: 102,840,962 I838K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trbv17 A C 6: 41,163,352 N47T probably benign Het
Washc3 T A 10: 88,216,009 S87T probably benign Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
PIT4431001:Cope UTSW 8 70312767 missense probably damaging 0.99
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1382:Cope UTSW 8 70312863 missense probably benign 0.00
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5106:Cope UTSW 8 70310447 missense possibly damaging 0.57
R5454:Cope UTSW 8 70304656 missense probably benign 0.17
R5764:Cope UTSW 8 70306581 missense probably damaging 1.00
R5979:Cope UTSW 8 70302543 splice site probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
R7074:Cope UTSW 8 70312887 missense probably benign 0.11
R8022:Cope UTSW 8 70312803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAAAAGCTGGTCTCCCTGATG -3'
(R):5'- CCCAGTAAGACCCTGTTTTAGAG -3'

Sequencing Primer
(F):5'- TCCCTGATGCACCATGTTAGGG -3'
(R):5'- ACCCTGTTTTAGAGAAGCCAG -3'
Posted On2015-08-18