Mutagenetix > Incidental Mutation

Incidental Mutation 'R4538:Cope'

333414

Institutional Source

Beutler Lab

Gene Symbol

Cope

Ensembl Gene

ENSMUSG00000055681

Gene Name

coatomer protein complex, subunit epsilon

Synonyms

1110005D17Rik, Cope1

MMRRC Submission

041775-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R4538 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

70755417-70765652 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70759157 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 16 (I16N)

Ref Sequence

ENSEMBL: ENSMUSP00000122888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008004] [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000150968] [ENSMUST00000168018]

AlphaFold

O89079

Predicted Effect

probably benign
Transcript: ENSMUST00000008004

SMART Domains

Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

Domain	Start	End	E-Value	Type
DEXDc	21	222	1.85e-57	SMART
HELICc	262	343	2.41e-29	SMART
low complexity region	369	383	N/A	INTRINSIC
low complexity region	461	470	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066469
AA Change: I100N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: I100N

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:Coatomer_E	15	305	2.8e-134	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127076

Predicted Effect

probably damaging
Transcript: ENSMUST00000128003
AA Change: I16N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681
AA Change: I16N

Domain	Start	End	E-Value	Type
Pfam:Coatomer_E	1	212	5.4e-95	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138688

Predicted Effect

probably damaging
Transcript: ENSMUST00000150968
AA Change: I100N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681
AA Change: I100N

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:Coatomer_E	15	227	6.5e-86	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168018
AA Change: H66Q

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681
AA Change: H66Q

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:Coatomer_E	15	79	4.5e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144890

Predicted Effect

probably benign
Transcript: ENSMUST00000167850

SMART Domains

Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681

Domain	Start	End	E-Value	Type
Pfam:Coatomer_E	1	79	5.4e-38	PFAM
Pfam:Coatomer_E	75	113	3.7e-12	PFAM

Meta Mutation Damage Score

0.8893

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110018I06Rik	G	A	12: 107,455,096 (GRCm39)	V61M	unknown	Het
Abcc9	A	G	6: 142,560,138 (GRCm39)		probably null	Het
Adcy10	A	T	1: 165,340,696 (GRCm39)	M234L	probably benign	Het
B4galt3	T	C	1: 171,100,280 (GRCm39)	F150S	probably damaging	Het
Bag4	C	T	8: 26,259,516 (GRCm39)	A228T	probably benign	Het
Chd4	A	T	6: 125,097,649 (GRCm39)	D1377V	probably damaging	Het
Cpd	A	T	11: 76,681,825 (GRCm39)	N1140K	probably benign	Het
Cyp7b1	A	T	3: 18,151,745 (GRCm39)	I156N	possibly damaging	Het
Depdc5	T	C	5: 33,141,290 (GRCm39)	Y1397H	probably damaging	Het
Dnajc13	CT	C	9: 104,064,004 (GRCm39)		probably benign	Het
Ebf1	T	A	11: 44,798,822 (GRCm39)	D289E	probably benign	Het
Egflam	T	C	15: 7,281,918 (GRCm39)	Y406C	probably damaging	Het
Hfm1	T	C	5: 107,022,756 (GRCm39)	T949A	possibly damaging	Het
Ifih1	A	G	2: 62,447,756 (GRCm39)	V316A	probably damaging	Het
Kif1a	C	T	1: 93,004,769 (GRCm39)	V142M	probably damaging	Het
Kng2	C	A	16: 22,806,813 (GRCm39)	R462L	probably benign	Het
Lrrn1	T	A	6: 107,545,598 (GRCm39)	N465K	probably benign	Het
Mdn1	T	A	4: 32,722,334 (GRCm39)	L2372Q	probably damaging	Het
Men1	T	C	19: 6,386,784 (GRCm39)	F159L	possibly damaging	Het
Mul1	T	C	4: 138,165,706 (GRCm39)		probably benign	Het
Or2l13b	A	T	16: 19,349,381 (GRCm39)	C96*	probably null	Het
Pramel6	T	G	2: 87,338,903 (GRCm39)	H34Q	probably benign	Het
Ripk4	A	T	16: 97,544,352 (GRCm39)	L702*	probably null	Het
Slc5a4a	C	T	10: 76,013,929 (GRCm39)	R379*	probably null	Het
Slc9a3	T	C	13: 74,309,851 (GRCm39)	V513A	possibly damaging	Het
Strada	A	C	11: 106,058,651 (GRCm39)	M245R	probably damaging	Het
Sycp1	A	T	3: 102,748,278 (GRCm39)	I838K	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Trbv17	A	C	6: 41,140,286 (GRCm39)	N47T	probably benign	Het
Washc3	T	A	10: 88,051,871 (GRCm39)	S87T	probably benign	Het

Other mutations in Cope

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02696:Cope	APN	8	70,763,143 (GRCm39)	critical splice donor site	probably null
PIT4431001:Cope	UTSW	8	70,765,417 (GRCm39)	missense	probably damaging	0.99
R0570:Cope	UTSW	8	70,759,181 (GRCm39)	missense	probably damaging	0.96
R1382:Cope	UTSW	8	70,765,513 (GRCm39)	missense	probably benign	0.00
R1518:Cope	UTSW	8	70,765,411 (GRCm39)	missense	possibly damaging	0.72
R4941:Cope	UTSW	8	70,755,584 (GRCm39)	critical splice donor site	probably null
R5106:Cope	UTSW	8	70,763,097 (GRCm39)	missense	possibly damaging	0.57
R5454:Cope	UTSW	8	70,757,306 (GRCm39)	missense	probably benign	0.17
R5764:Cope	UTSW	8	70,759,231 (GRCm39)	missense	probably damaging	1.00
R5979:Cope	UTSW	8	70,755,193 (GRCm39)	splice site	probably null
R6003:Cope	UTSW	8	70,757,285 (GRCm39)	missense	probably benign	0.01
R6010:Cope	UTSW	8	70,761,162 (GRCm39)	missense	probably damaging	1.00
R7074:Cope	UTSW	8	70,765,537 (GRCm39)	missense	probably benign	0.11
R8022:Cope	UTSW	8	70,765,453 (GRCm39)	missense	probably benign	0.01
R9309:Cope	UTSW	8	70,755,482 (GRCm39)	missense	unknown
R9326:Cope	UTSW	8	70,755,516 (GRCm39)	missense	possibly damaging	0.59
R9341:Cope	UTSW	8	70,761,228 (GRCm39)	critical splice donor site	probably null
R9343:Cope	UTSW	8	70,761,228 (GRCm39)	critical splice donor site	probably null
R9501:Cope	UTSW	8	70,765,363 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCAAAAGCTGGTCTCCCTGATG -3'
(R):5'- CCCAGTAAGACCCTGTTTTAGAG -3'

Sequencing Primer
(F):5'- TCCCTGATGCACCATGTTAGGG -3'
(R):5'- ACCCTGTTTTAGAGAAGCCAG -3'

Posted On

2015-08-18