Incidental Mutation 'R4538:3110018I06Rik'
ID333421
Institutional Source Beutler Lab
Gene Symbol 3110018I06Rik
Ensembl Gene ENSMUSG00000060375
Gene NameRIKEN cDNA 3110018I06 gene
Synonyms
MMRRC Submission 041775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4538 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location107488632-107489636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107488837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 61 (V61M)
Ref Sequence ENSEMBL: ENSMUSP00000080894 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000082269
AA Change: V61M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223301
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,614,412 probably null Het
Adcy10 A T 1: 165,513,127 M234L probably benign Het
B4galt3 T C 1: 171,272,710 F150S probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Chd4 A T 6: 125,120,686 D1377V probably damaging Het
Cope T A 8: 70,306,507 I16N probably damaging Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cyp7b1 A T 3: 18,097,581 I156N possibly damaging Het
Depdc5 T C 5: 32,983,946 Y1397H probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Ebf1 T A 11: 44,907,995 D289E probably benign Het
Egflam T C 15: 7,252,437 Y406C probably damaging Het
Hfm1 T C 5: 106,874,890 T949A possibly damaging Het
Ifih1 A G 2: 62,617,412 V316A probably damaging Het
Kif1a C T 1: 93,077,047 V142M probably damaging Het
Kng2 C A 16: 22,988,063 R462L probably benign Het
Lrrn1 T A 6: 107,568,637 N465K probably benign Het
Mdn1 T A 4: 32,722,334 L2372Q probably damaging Het
Men1 T C 19: 6,336,754 F159L possibly damaging Het
Mul1 T C 4: 138,438,395 probably benign Het
Olfr168 A T 16: 19,530,631 C96* probably null Het
Pramel6 T G 2: 87,508,559 H34Q probably benign Het
Ripk4 A T 16: 97,743,152 L702* probably null Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Slc9a3 T C 13: 74,161,732 V513A possibly damaging Het
Strada A C 11: 106,167,825 M245R probably damaging Het
Sycp1 A T 3: 102,840,962 I838K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trbv17 A C 6: 41,163,352 N47T probably benign Het
Washc3 T A 10: 88,216,009 S87T probably benign Het
Other mutations in 3110018I06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0944:3110018I06Rik UTSW 12 107489009 missense unknown
R7661:3110018I06Rik UTSW 12 107488956 missense unknown
Z1176:3110018I06Rik UTSW 12 107488855 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGTCAGCACAAGAGTCTATC -3'
(R):5'- ATACATCCTGGAAACCAAGGG -3'

Sequencing Primer
(F):5'- GAGTCAGCACAAGAGTCTATCTTAGC -3'
(R):5'- GTGAAATGTGAACTTAAGGGTGTC -3'
Posted On2015-08-18