Mutagenetix > Incidental Mutation

Incidental Mutation 'R4538:Slc9a3'

333422

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

041775-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4538 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74161732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 513 (V513A)

Ref Sequence

ENSEMBL: ENSMUSP00000153255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably benign
Transcript: ENSMUST00000036208
AA Change: V513A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: V513A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221703
AA Change: V513A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225423
AA Change: V513A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

Meta Mutation Damage Score

0.1806

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110018I06Rik	G	A	12: 107,488,837	V61M	unknown	Het
Abcc9	A	G	6: 142,614,412		probably null	Het
Adcy10	A	T	1: 165,513,127	M234L	probably benign	Het
B4galt3	T	C	1: 171,272,710	F150S	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Chd4	A	T	6: 125,120,686	D1377V	probably damaging	Het
Cope	T	A	8: 70,306,507	I16N	probably damaging	Het
Cpd	A	T	11: 76,790,999	N1140K	probably benign	Het
Cyp7b1	A	T	3: 18,097,581	I156N	possibly damaging	Het
Depdc5	T	C	5: 32,983,946	Y1397H	probably damaging	Het
Dnajc13	CT	C	9: 104,186,805		probably benign	Het
Ebf1	T	A	11: 44,907,995	D289E	probably benign	Het
Egflam	T	C	15: 7,252,437	Y406C	probably damaging	Het
Hfm1	T	C	5: 106,874,890	T949A	possibly damaging	Het
Ifih1	A	G	2: 62,617,412	V316A	probably damaging	Het
Kif1a	C	T	1: 93,077,047	V142M	probably damaging	Het
Kng2	C	A	16: 22,988,063	R462L	probably benign	Het
Lrrn1	T	A	6: 107,568,637	N465K	probably benign	Het
Mdn1	T	A	4: 32,722,334	L2372Q	probably damaging	Het
Men1	T	C	19: 6,336,754	F159L	possibly damaging	Het
Mul1	T	C	4: 138,438,395		probably benign	Het
Olfr168	A	T	16: 19,530,631	C96*	probably null	Het
Pramel6	T	G	2: 87,508,559	H34Q	probably benign	Het
Ripk4	A	T	16: 97,743,152	L702*	probably null	Het
Slc5a4a	C	T	10: 76,178,095	R379*	probably null	Het
Strada	A	C	11: 106,167,825	M245R	probably damaging	Het
Sycp1	A	T	3: 102,840,962	I838K	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trbv17	A	C	6: 41,163,352	N47T	probably benign	Het
Washc3	T	A	10: 88,216,009	S87T	probably benign	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
R9741:Slc9a3	UTSW	13	74158875	missense	possibly damaging	0.95
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGGCATGATGACCTTTCAC -3'
(R):5'- TATGCCCTAGACCGCATCTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GACCGCATCTGATGTTTTACTTTAG -3'

Posted On

2015-08-18