Incidental Mutation 'R4538:Slc9a3'
ID333422
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms9030624O13Rik, NHE-3, NHE3
MMRRC Submission 041775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4538 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74121457-74169442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74161732 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 513 (V513A)
Ref Sequence ENSEMBL: ENSMUSP00000153255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably benign
Transcript: ENSMUST00000036208
AA Change: V513A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: V513A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221703
AA Change: V513A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225423
AA Change: V513A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1806 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,488,837 V61M unknown Het
Abcc9 A G 6: 142,614,412 probably null Het
Adcy10 A T 1: 165,513,127 M234L probably benign Het
B4galt3 T C 1: 171,272,710 F150S probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Chd4 A T 6: 125,120,686 D1377V probably damaging Het
Cope T A 8: 70,306,507 I16N probably damaging Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cyp7b1 A T 3: 18,097,581 I156N possibly damaging Het
Depdc5 T C 5: 32,983,946 Y1397H probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Ebf1 T A 11: 44,907,995 D289E probably benign Het
Egflam T C 15: 7,252,437 Y406C probably damaging Het
Hfm1 T C 5: 106,874,890 T949A possibly damaging Het
Ifih1 A G 2: 62,617,412 V316A probably damaging Het
Kif1a C T 1: 93,077,047 V142M probably damaging Het
Kng2 C A 16: 22,988,063 R462L probably benign Het
Lrrn1 T A 6: 107,568,637 N465K probably benign Het
Mdn1 T A 4: 32,722,334 L2372Q probably damaging Het
Men1 T C 19: 6,336,754 F159L possibly damaging Het
Mul1 T C 4: 138,438,395 probably benign Het
Olfr168 A T 16: 19,530,631 C96* probably null Het
Pramel6 T G 2: 87,508,559 H34Q probably benign Het
Ripk4 A T 16: 97,743,152 L702* probably null Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Strada A C 11: 106,167,825 M245R probably damaging Het
Sycp1 A T 3: 102,840,962 I838K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trbv17 A C 6: 41,163,352 N47T probably benign Het
Washc3 T A 10: 88,216,009 S87T probably benign Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGGCATGATGACCTTTCAC -3'
(R):5'- TATGCCCTAGACCGCATCTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GACCGCATCTGATGTTTTACTTTAG -3'
Posted On2015-08-18