Incidental Mutation 'R4539:Myo3b'
ID333433
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4539 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to G at 70039147 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208]
Predicted Effect probably null
Transcript: ENSMUST00000060208
AA Change: M1R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: M1R

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140978
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,715,793 T702A probably benign Het
Alms1 C T 6: 85,620,478 T762I possibly damaging Het
Arhgef18 T C 8: 3,447,070 M465T probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Camta1 T C 4: 151,084,812 I161V probably benign Het
Cpeb4 G A 11: 31,873,206 G307S probably damaging Het
Eps8l1 T C 7: 4,478,624 V707A probably damaging Het
Espn G A 4: 152,134,208 Q473* probably null Het
Fut9 A T 4: 25,619,793 H340Q probably damaging Het
Gm11554 A T 11: 99,804,360 probably benign Het
Hcar2 A G 5: 123,864,730 F237L probably damaging Het
Hectd4 T A 5: 121,314,907 C492* probably null Het
Lrrk2 C T 15: 91,729,142 P823L possibly damaging Het
Luzp2 A T 7: 55,063,289 Q91L probably damaging Het
Mapkapk5 T A 5: 121,537,155 H117L possibly damaging Het
Myh14 A G 7: 44,627,054 L1209P probably damaging Het
Nacad A T 11: 6,600,677 V838E possibly damaging Het
Neurl1a T A 19: 47,256,744 S458T probably damaging Het
Pdzrn4 A G 15: 92,770,589 D874G probably damaging Het
Phykpl A G 11: 51,594,088 T292A probably damaging Het
Piezo2 A G 18: 63,086,628 Y1003H probably damaging Het
Ppih A G 4: 119,320,459 S6P probably benign Het
Qrich1 A G 9: 108,534,200 E308G probably damaging Het
Setx A G 2: 29,179,748 T2522A probably benign Het
Slc26a8 A T 17: 28,659,617 M332K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sphkap A G 1: 83,277,793 V745A probably benign Het
Swi5 T C 2: 32,279,080 N118S possibly damaging Het
Tenm2 T C 11: 36,046,780 T1689A probably damaging Het
Ttll9 C T 2: 152,994,091 R252C probably damaging Het
Vars2 T A 17: 35,666,888 E80V probably damaging Het
Zbtb39 G A 10: 127,742,192 D212N possibly damaging Het
Zfp418 C A 7: 7,181,277 Q80K probably benign Het
Zscan25 A G 5: 145,288,391 D259G probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGTAGCGCCTCAGCTTC -3'
(R):5'- CCTGCACATCTGATGGCTTC -3'

Sequencing Primer
(F):5'- GCCTCAGCTTCAGCACAGAG -3'
(R):5'- GGAAGGAAGAGTTAGCCATTCTTTC -3'
Posted On2015-08-18