Incidental Mutation 'R4539:Ttll9'
ID333434
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4539 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152994091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 252 (R252C)
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably damaging
Transcript: ENSMUST00000099197
AA Change: R252C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: R252C

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103155
AA Change: R252C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: R252C

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130021
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,715,793 T702A probably benign Het
Alms1 C T 6: 85,620,478 T762I possibly damaging Het
Arhgef18 T C 8: 3,447,070 M465T probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Camta1 T C 4: 151,084,812 I161V probably benign Het
Cpeb4 G A 11: 31,873,206 G307S probably damaging Het
Eps8l1 T C 7: 4,478,624 V707A probably damaging Het
Espn G A 4: 152,134,208 Q473* probably null Het
Fut9 A T 4: 25,619,793 H340Q probably damaging Het
Gm11554 A T 11: 99,804,360 probably benign Het
Hcar2 A G 5: 123,864,730 F237L probably damaging Het
Hectd4 T A 5: 121,314,907 C492* probably null Het
Lrrk2 C T 15: 91,729,142 P823L possibly damaging Het
Luzp2 A T 7: 55,063,289 Q91L probably damaging Het
Mapkapk5 T A 5: 121,537,155 H117L possibly damaging Het
Myh14 A G 7: 44,627,054 L1209P probably damaging Het
Myo3b T G 2: 70,039,147 M1R probably null Het
Nacad A T 11: 6,600,677 V838E possibly damaging Het
Neurl1a T A 19: 47,256,744 S458T probably damaging Het
Pdzrn4 A G 15: 92,770,589 D874G probably damaging Het
Phykpl A G 11: 51,594,088 T292A probably damaging Het
Piezo2 A G 18: 63,086,628 Y1003H probably damaging Het
Ppih A G 4: 119,320,459 S6P probably benign Het
Qrich1 A G 9: 108,534,200 E308G probably damaging Het
Setx A G 2: 29,179,748 T2522A probably benign Het
Slc26a8 A T 17: 28,659,617 M332K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sphkap A G 1: 83,277,793 V745A probably benign Het
Swi5 T C 2: 32,279,080 N118S possibly damaging Het
Tenm2 T C 11: 36,046,780 T1689A probably damaging Het
Vars2 T A 17: 35,666,888 E80V probably damaging Het
Zbtb39 G A 10: 127,742,192 D212N possibly damaging Het
Zfp418 C A 7: 7,181,277 Q80K probably benign Het
Zscan25 A G 5: 145,288,391 D259G probably benign Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7945:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAGACCCATCGTTAGGGCAG -3'
(R):5'- AGAGAAAGGTCTGGGCTCTC -3'

Sequencing Primer
(F):5'- CCCATCGTTAGGGCAGGAAGG -3'
(R):5'- GGAGGATACAGTGGTCAT -3'
Posted On2015-08-18