Incidental Mutation 'R4539:Fut9'
ID 333438
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFuc-TIX, mFUT9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4539 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 25609332-25800244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25619793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 340 (H340Q)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: H340Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: H340Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: H340Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: H340Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,715,793 T702A probably benign Het
Alms1 C T 6: 85,620,478 T762I possibly damaging Het
Arhgef18 T C 8: 3,447,070 M465T probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Camta1 T C 4: 151,084,812 I161V probably benign Het
Cpeb4 G A 11: 31,873,206 G307S probably damaging Het
Eps8l1 T C 7: 4,478,624 V707A probably damaging Het
Espn G A 4: 152,134,208 Q473* probably null Het
Gm11554 A T 11: 99,804,360 probably benign Het
Hcar2 A G 5: 123,864,730 F237L probably damaging Het
Hectd4 T A 5: 121,314,907 C492* probably null Het
Lrrk2 C T 15: 91,729,142 P823L possibly damaging Het
Luzp2 A T 7: 55,063,289 Q91L probably damaging Het
Mapkapk5 T A 5: 121,537,155 H117L possibly damaging Het
Myh14 A G 7: 44,627,054 L1209P probably damaging Het
Myo3b T G 2: 70,039,147 M1R probably null Het
Nacad A T 11: 6,600,677 V838E possibly damaging Het
Neurl1a T A 19: 47,256,744 S458T probably damaging Het
Pdzrn4 A G 15: 92,770,589 D874G probably damaging Het
Phykpl A G 11: 51,594,088 T292A probably damaging Het
Piezo2 A G 18: 63,086,628 Y1003H probably damaging Het
Ppih A G 4: 119,320,459 S6P probably benign Het
Qrich1 A G 9: 108,534,200 E308G probably damaging Het
Setx A G 2: 29,179,748 T2522A probably benign Het
Slc26a8 A T 17: 28,659,617 M332K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sphkap A G 1: 83,277,793 V745A probably benign Het
Swi5 T C 2: 32,279,080 N118S possibly damaging Het
Tenm2 T C 11: 36,046,780 T1689A probably damaging Het
Ttll9 C T 2: 152,994,091 R252C probably damaging Het
Vars2 T A 17: 35,666,888 E80V probably damaging Het
Zbtb39 G A 10: 127,742,192 D212N possibly damaging Het
Zfp418 C A 7: 7,181,277 Q80K probably benign Het
Zscan25 A G 5: 145,288,391 D259G probably benign Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25620359 missense probably damaging 1.00
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2165:Fut9 UTSW 4 25619734 makesense probably null
R2332:Fut9 UTSW 4 25619823 nonsense probably null
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5025:Fut9 UTSW 4 25620502 missense probably damaging 1.00
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R6825:Fut9 UTSW 4 25619925 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
R7573:Fut9 UTSW 4 25620691 missense probably benign 0.04
R8933:Fut9 UTSW 4 25619861 missense probably damaging 1.00
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAAAATATACATGGTCCTCAAGGG -3'
(R):5'- GGGTCCATCTAGGGAAAACTATGAG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGGCAGGAAAATTAAAC -3'
(R):5'- CTCCCAGTGAGTTAGCAA -3'
Posted On 2015-08-18