Incidental Mutation 'R4539:Fut9'
ID 333438
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4539 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25619793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 340 (H340Q)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: H340Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: H340Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: H340Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: H340Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,765,793 (GRCm39) T702A probably benign Het
Alms1 C T 6: 85,597,460 (GRCm39) T762I possibly damaging Het
Arhgef18 T C 8: 3,497,070 (GRCm39) M465T probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Camta1 T C 4: 151,169,269 (GRCm39) I161V probably benign Het
Cpeb4 G A 11: 31,823,206 (GRCm39) G307S probably damaging Het
Eps8l1 T C 7: 4,481,623 (GRCm39) V707A probably damaging Het
Espn G A 4: 152,218,665 (GRCm39) Q473* probably null Het
Gm11554 A T 11: 99,695,186 (GRCm39) probably benign Het
Hcar2 A G 5: 124,002,793 (GRCm39) F237L probably damaging Het
Hectd4 T A 5: 121,452,970 (GRCm39) C492* probably null Het
Lrrk2 C T 15: 91,613,345 (GRCm39) P823L possibly damaging Het
Luzp2 A T 7: 54,713,037 (GRCm39) Q91L probably damaging Het
Mapkapk5 T A 5: 121,675,218 (GRCm39) H117L possibly damaging Het
Myh14 A G 7: 44,276,478 (GRCm39) L1209P probably damaging Het
Myo3b T G 2: 69,869,491 (GRCm39) M1R probably null Het
Nacad A T 11: 6,550,677 (GRCm39) V838E possibly damaging Het
Neurl1a T A 19: 47,245,183 (GRCm39) S458T probably damaging Het
Pdzrn4 A G 15: 92,668,470 (GRCm39) D874G probably damaging Het
Phykpl A G 11: 51,484,915 (GRCm39) T292A probably damaging Het
Piezo2 A G 18: 63,219,699 (GRCm39) Y1003H probably damaging Het
Ppih A G 4: 119,177,656 (GRCm39) S6P probably benign Het
Qrich1 A G 9: 108,411,399 (GRCm39) E308G probably damaging Het
Setx A G 2: 29,069,760 (GRCm39) T2522A probably benign Het
Slc26a8 A T 17: 28,878,591 (GRCm39) M332K probably benign Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Sphkap A G 1: 83,255,514 (GRCm39) V745A probably benign Het
Swi5 T C 2: 32,169,092 (GRCm39) N118S possibly damaging Het
Tenm2 T C 11: 35,937,607 (GRCm39) T1689A probably damaging Het
Ttll9 C T 2: 152,836,011 (GRCm39) R252C probably damaging Het
Vars2 T A 17: 35,977,780 (GRCm39) E80V probably damaging Het
Zbtb39 G A 10: 127,578,061 (GRCm39) D212N possibly damaging Het
Zfp418 C A 7: 7,184,276 (GRCm39) Q80K probably benign Het
Zscan25 A G 5: 145,225,201 (GRCm39) D259G probably benign Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25,620,359 (GRCm39) missense probably damaging 1.00
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,734 (GRCm39) makesense probably null
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5158:Fut9 UTSW 4 25,620,731 (GRCm39) missense probably benign 0.01
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6315:Fut9 UTSW 4 25,619,774 (GRCm39) missense probably damaging 1.00
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R6825:Fut9 UTSW 4 25,619,925 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAAAATATACATGGTCCTCAAGGG -3'
(R):5'- GGGTCCATCTAGGGAAAACTATGAG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGGCAGGAAAATTAAAC -3'
(R):5'- CTCCCAGTGAGTTAGCAA -3'
Posted On 2015-08-18