Mutagenetix > Incidental Mutation

Incidental Mutation 'R4539:Alms1'

333449

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4539 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85620478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 762 (T762I)

Ref Sequence

ENSEMBL: ENSMUSP00000071904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072018
AA Change: T762I

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: T762I

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213058
AA Change: T1231I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,715,793	T702A	probably benign	Het
Arhgef18	T	C	8: 3,447,070	M465T	probably benign	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Camta1	T	C	4: 151,084,812	I161V	probably benign	Het
Cpeb4	G	A	11: 31,873,206	G307S	probably damaging	Het
Eps8l1	T	C	7: 4,478,624	V707A	probably damaging	Het
Espn	G	A	4: 152,134,208	Q473*	probably null	Het
Fut9	A	T	4: 25,619,793	H340Q	probably damaging	Het
Gm11554	A	T	11: 99,804,360		probably benign	Het
Hcar2	A	G	5: 123,864,730	F237L	probably damaging	Het
Hectd4	T	A	5: 121,314,907	C492*	probably null	Het
Lrrk2	C	T	15: 91,729,142	P823L	possibly damaging	Het
Luzp2	A	T	7: 55,063,289	Q91L	probably damaging	Het
Mapkapk5	T	A	5: 121,537,155	H117L	possibly damaging	Het
Myh14	A	G	7: 44,627,054	L1209P	probably damaging	Het
Myo3b	T	G	2: 70,039,147	M1R	probably null	Het
Nacad	A	T	11: 6,600,677	V838E	possibly damaging	Het
Neurl1a	T	A	19: 47,256,744	S458T	probably damaging	Het
Pdzrn4	A	G	15: 92,770,589	D874G	probably damaging	Het
Phykpl	A	G	11: 51,594,088	T292A	probably damaging	Het
Piezo2	A	G	18: 63,086,628	Y1003H	probably damaging	Het
Ppih	A	G	4: 119,320,459	S6P	probably benign	Het
Qrich1	A	G	9: 108,534,200	E308G	probably damaging	Het
Setx	A	G	2: 29,179,748	T2522A	probably benign	Het
Slc26a8	A	T	17: 28,659,617	M332K	probably benign	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sphkap	A	G	1: 83,277,793	V745A	probably benign	Het
Swi5	T	C	2: 32,279,080	N118S	possibly damaging	Het
Tenm2	T	C	11: 36,046,780	T1689A	probably damaging	Het
Ttll9	C	T	2: 152,994,091	R252C	probably damaging	Het
Vars2	T	A	17: 35,666,888	E80V	probably damaging	Het
Zbtb39	G	A	10: 127,742,192	D212N	possibly damaging	Het
Zfp418	C	A	7: 7,181,277	Q80K	probably benign	Het
Zscan25	A	G	5: 145,288,391	D259G	probably benign	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CCTACCAGTTAACCTTGCCAG -3'
(R):5'- AAATCCGAGGCTTTTCTCTTTGTG -3'

Sequencing Primer
(F):5'- CCTGAAGATGTTTTCAAAGCTTCTTC -3'
(R):5'- CTCTTTGTGAGAAAGCAGCAG -3'

Posted On

2015-08-18