Incidental Mutation 'R4539:Pdzrn4'
ID333468
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene NamePDZ domain containing RING finger 4
Synonyms1110017D07Rik, LNX4, SAMCAP3L
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R4539 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location92396881-92771819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92770589 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 874 (D874G)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
Predicted Effect probably damaging
Transcript: ENSMUST00000035399
AA Change: D635G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: D635G

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: D874G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: D874G

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,715,793 T702A probably benign Het
Alms1 C T 6: 85,620,478 T762I possibly damaging Het
Arhgef18 T C 8: 3,447,070 M465T probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Camta1 T C 4: 151,084,812 I161V probably benign Het
Cpeb4 G A 11: 31,873,206 G307S probably damaging Het
Eps8l1 T C 7: 4,478,624 V707A probably damaging Het
Espn G A 4: 152,134,208 Q473* probably null Het
Fut9 A T 4: 25,619,793 H340Q probably damaging Het
Gm11554 A T 11: 99,804,360 probably benign Het
Hcar2 A G 5: 123,864,730 F237L probably damaging Het
Hectd4 T A 5: 121,314,907 C492* probably null Het
Lrrk2 C T 15: 91,729,142 P823L possibly damaging Het
Luzp2 A T 7: 55,063,289 Q91L probably damaging Het
Mapkapk5 T A 5: 121,537,155 H117L possibly damaging Het
Myh14 A G 7: 44,627,054 L1209P probably damaging Het
Myo3b T G 2: 70,039,147 M1R probably null Het
Nacad A T 11: 6,600,677 V838E possibly damaging Het
Neurl1a T A 19: 47,256,744 S458T probably damaging Het
Phykpl A G 11: 51,594,088 T292A probably damaging Het
Piezo2 A G 18: 63,086,628 Y1003H probably damaging Het
Ppih A G 4: 119,320,459 S6P probably benign Het
Qrich1 A G 9: 108,534,200 E308G probably damaging Het
Setx A G 2: 29,179,748 T2522A probably benign Het
Slc26a8 A T 17: 28,659,617 M332K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sphkap A G 1: 83,277,793 V745A probably benign Het
Swi5 T C 2: 32,279,080 N118S possibly damaging Het
Tenm2 T C 11: 36,046,780 T1689A probably damaging Het
Ttll9 C T 2: 152,994,091 R252C probably damaging Het
Vars2 T A 17: 35,666,888 E80V probably damaging Het
Zbtb39 G A 10: 127,742,192 D212N possibly damaging Het
Zfp418 C A 7: 7,181,277 Q80K probably benign Het
Zscan25 A G 5: 145,288,391 D259G probably benign Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92677637 missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92770864 missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92770422 nonsense probably null
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92770067 missense possibly damaging 0.68
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACAGCTCCTCCTACAGATATGC -3'
(R):5'- GACTCCGCATCATGAACTCC -3'

Sequencing Primer
(F):5'- TACAGATATGCCAACATTCCGG -3'
(R):5'- ATCATGAACTCCCGGCGC -3'
Posted On2015-08-18