Incidental Mutation 'R4540:Pth2r'
ID333473
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65282201 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 13 (N13S)
Ref Sequence ENSEMBL: ENSMUSP00000114594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000140190]
Predicted Effect probably benign
Transcript: ENSMUST00000081154
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140190
AA Change: N13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114594
Gene: ENSMUSG00000025946
AA Change: N13S

DomainStartEndE-ValueType
HormR 54 129 8.15e-28 SMART
Pfam:7tm_2 134 174 1.1e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATGATCAGGTTTGGAGTAAAC -3'
(R):5'- CAGTTTGCCCTGAATTTCATACTATG -3'

Sequencing Primer
(F):5'- TCCTGCGACTCATGATGGAAG -3'
(R):5'- GCCCTGAATTTCATACTATGTTTTTG -3'
Posted On2015-08-18