Incidental Mutation 'R4540:Selenoi'
ID333484
Institutional Source Beutler Lab
Gene Symbol Selenoi
Ensembl Gene ENSMUSG00000075703
Gene Nameselenoprotein I
Synonyms4933402G07Rik, Ept1, C79563, D5Wsu178e
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30232581-30272427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30256087 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 107 (D107G)
Ref Sequence ENSEMBL: ENSMUSP00000118368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132404] [ENSMUST00000145167] [ENSMUST00000145858]
Predicted Effect probably damaging
Transcript: ENSMUST00000132404
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117343
Gene: ENSMUSG00000075703
AA Change: D82G

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 46 188 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138001
Predicted Effect probably damaging
Transcript: ENSMUST00000145167
AA Change: D107G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118368
Gene: ENSMUSG00000075703
AA Change: D107G

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 48 129 1.8e-16 PFAM
low complexity region 151 167 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145858
Meta Mutation Damage Score 0.9560 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The multi-pass transmembrane protein encoded by this gene belongs to the CDP-alcohol phosphatidyltransferase class-I family. It catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine, which is involved in the formation and maintenance of vesicular membranes, regulation of lipid metabolism, and protein folding. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Selenoi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Selenoi APN 5 30256224 missense probably damaging 0.97
IGL01645:Selenoi APN 5 30257823 unclassified probably benign
IGL03136:Selenoi APN 5 30257727 missense probably damaging 1.00
IGL03232:Selenoi APN 5 30256261 missense probably damaging 1.00
R0506:Selenoi UTSW 5 30266956 missense probably benign 0.00
R1750:Selenoi UTSW 5 30257773 missense probably benign 0.32
R3767:Selenoi UTSW 5 30256189 missense probably damaging 1.00
R3925:Selenoi UTSW 5 30256088 missense probably damaging 1.00
R4797:Selenoi UTSW 5 30252742 missense probably damaging 1.00
R7461:Selenoi UTSW 5 30266928 missense possibly damaging 0.50
R7613:Selenoi UTSW 5 30266928 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTTCGTGCCCAACTTGGAG -3'
(R):5'- TCTCCCAGTGAGACAGGATAAAAG -3'

Sequencing Primer
(F):5'- AGCTCCTGGGAATTCAACG -3'
(R):5'- CCCAGTGAGACAGGATAAAAGAAAAC -3'
Posted On2015-08-18