Incidental Mutation 'R4540:Mag'
ID 333488
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Name myelin-associated glycoprotein
Synonyms Gma, siglec-4a
MMRRC Submission 041776-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4540 (G1)
Quality Score 194
Status Validated
Chromosome 7
Chromosomal Location 30598601-30614298 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 30600154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 500 (V500G)
Ref Sequence ENSEMBL: ENSMUSP00000140526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000191081]
AlphaFold P20917
Predicted Effect possibly damaging
Transcript: ENSMUST00000040548
AA Change: V542G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634
AA Change: V542G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187137
AA Change: V542G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634
AA Change: V542G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188569
AA Change: V500G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634
AA Change: V500G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191081
AA Change: V542G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634
AA Change: V542G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,508,119 (GRCm39) H164L probably damaging Het
Arrdc3 C A 13: 81,038,790 (GRCm39) R31S possibly damaging Het
Baiap3 C T 17: 25,465,644 (GRCm39) V585M probably damaging Het
Braf A G 6: 39,621,267 (GRCm39) S391P probably damaging Het
Ccdc51 T C 9: 108,921,288 (GRCm39) F392L possibly damaging Het
Cd1d1 A G 3: 86,904,012 (GRCm39) I194T probably benign Het
Cep162 T C 9: 87,094,992 (GRCm39) K806E probably damaging Het
Cntn4 A G 6: 106,652,709 (GRCm39) E726G probably damaging Het
Col11a1 A G 3: 113,890,815 (GRCm39) Y384C unknown Het
Cops3 A T 11: 59,720,980 (GRCm39) L145H probably damaging Het
Cul9 C T 17: 46,814,015 (GRCm39) M2286I probably null Het
Echdc1 G A 10: 29,220,578 (GRCm39) V245I probably benign Het
Fsip2 A T 2: 82,782,009 (GRCm39) M261L probably benign Het
Gm4353 A G 7: 115,683,212 (GRCm39) L123P probably benign Het
Hcfc2 G C 10: 82,568,481 (GRCm39) E42Q probably benign Het
Hfm1 A C 5: 107,022,087 (GRCm39) Y199* probably null Het
Iba57 G A 11: 59,053,904 (GRCm39) probably benign Het
Ihh T A 1: 74,987,558 (GRCm39) N161I possibly damaging Het
Kcnh7 A G 2: 62,569,530 (GRCm39) S789P probably damaging Het
Kndc1 C A 7: 139,501,343 (GRCm39) C877* probably null Het
Lhcgr A G 17: 89,063,036 (GRCm39) I212T probably benign Het
Lrrtm2 T A 18: 35,346,199 (GRCm39) T368S probably benign Het
Nadsyn1 A G 7: 143,356,960 (GRCm39) V512A probably damaging Het
Nlrp3 G A 11: 59,442,725 (GRCm39) C759Y possibly damaging Het
Nup107 T C 10: 117,597,925 (GRCm39) probably null Het
Or4c3d T C 2: 89,882,494 (GRCm39) Y58C probably damaging Het
Or4f56 T C 2: 111,703,546 (GRCm39) Y218C probably damaging Het
Pcdha1 A C 18: 37,064,680 (GRCm39) D448A probably damaging Het
Pitrm1 T A 13: 6,605,506 (GRCm39) probably null Het
Pth2r A G 1: 65,321,360 (GRCm39) N13S probably benign Het
Rae1 G T 2: 172,857,185 (GRCm39) probably benign Het
Selenoi A G 5: 30,461,085 (GRCm39) D107G probably damaging Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Spag17 C T 3: 99,995,697 (GRCm39) P1779S probably damaging Het
Supt3 T C 17: 45,347,662 (GRCm39) V208A probably benign Het
Tbc1d30 T C 10: 121,115,063 (GRCm39) E365G probably damaging Het
Tnxb C T 17: 34,922,309 (GRCm39) T2374I possibly damaging Het
Trip12 A G 1: 84,726,997 (GRCm39) I1T probably damaging Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30,599,812 (GRCm39) missense probably benign 0.00
IGL02036:Mag APN 7 30,607,877 (GRCm39) missense probably damaging 0.97
IGL03263:Mag APN 7 30,598,953 (GRCm39) splice site probably null
regie UTSW 7 30,600,154 (GRCm39) missense probably damaging 0.98
R0005:Mag UTSW 7 30,607,779 (GRCm39) splice site probably benign
R0403:Mag UTSW 7 30,606,405 (GRCm39) missense probably damaging 1.00
R1590:Mag UTSW 7 30,601,277 (GRCm39) missense probably damaging 0.99
R1874:Mag UTSW 7 30,608,476 (GRCm39) missense probably benign 0.13
R2170:Mag UTSW 7 30,608,412 (GRCm39) nonsense probably null
R2192:Mag UTSW 7 30,600,066 (GRCm39) nonsense probably null
R3176:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3177:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3276:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3277:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R4635:Mag UTSW 7 30,606,348 (GRCm39) missense probably damaging 1.00
R4704:Mag UTSW 7 30,608,598 (GRCm39) missense probably damaging 1.00
R4891:Mag UTSW 7 30,599,793 (GRCm39) missense possibly damaging 0.77
R4940:Mag UTSW 7 30,608,625 (GRCm39) missense probably damaging 1.00
R4952:Mag UTSW 7 30,608,581 (GRCm39) nonsense probably null
R6301:Mag UTSW 7 30,600,104 (GRCm39) missense probably damaging 1.00
R6441:Mag UTSW 7 30,606,508 (GRCm39) missense possibly damaging 0.65
R6951:Mag UTSW 7 30,610,858 (GRCm39) missense possibly damaging 0.89
R7562:Mag UTSW 7 30,608,559 (GRCm39) missense possibly damaging 0.83
R8312:Mag UTSW 7 30,610,894 (GRCm39) missense probably damaging 1.00
R9318:Mag UTSW 7 30,599,793 (GRCm39) missense possibly damaging 0.77
X0024:Mag UTSW 7 30,606,496 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACCCATGAGTCTGGCC -3'
(R):5'- TACGAGAATGTCTCCCTGGG -3'

Sequencing Primer
(F):5'- ATGAGTCTGGCCTCCCTTTTG -3'
(R):5'- AGAATGTCTCCCTGGGGACAC -3'
Posted On 2015-08-18