Incidental Mutation 'R4540:Cep162'
ID333493
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87212939 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 806 (K806E)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably damaging
Transcript: ENSMUST00000093802
AA Change: K806E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: K806E

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGACTACAAGCTATGTTCAGGG -3'
(R):5'- CAGGCTGTGGGAAGTTACTG -3'

Sequencing Primer
(F):5'- TGCTCACCTGTGGCATA -3'
(R):5'- GGTAGAGCACCTTCTGTCCC -3'
Posted On2015-08-18