Incidental Mutation 'R4540:Ccdc51'
ID333494
Institutional Source Beutler Lab
Gene Symbol Ccdc51
Ensembl Gene ENSMUSG00000025645
Gene Namecoiled-coil domain containing 51
Synonyms5730568A12Rik
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109082493-109092489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109092220 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 392 (F392L)
Ref Sequence ENSEMBL: ENSMUSP00000026735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026735] [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026735
AA Change: F392L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026735
Gene: ENSMUSG00000025645
AA Change: F392L

DomainStartEndE-ValueType
coiled coil region 109 162 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
low complexity region 274 286 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134690
Meta Mutation Damage Score 0.3721 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Ccdc51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Ccdc51 APN 9 109092184 missense probably damaging 1.00
IGL02615:Ccdc51 APN 9 109089435 missense probably benign
IGL02806:Ccdc51 APN 9 109092248 missense probably benign 0.00
R0100:Ccdc51 UTSW 9 109091998 nonsense probably null
R0137:Ccdc51 UTSW 9 109091630 missense probably damaging 1.00
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R4669:Ccdc51 UTSW 9 109090962 missense probably benign 0.00
R4770:Ccdc51 UTSW 9 109090910 missense probably benign
R5364:Ccdc51 UTSW 9 109092120 missense possibly damaging 0.82
R6137:Ccdc51 UTSW 9 109089415 missense probably benign 0.21
R7146:Ccdc51 UTSW 9 109091780 missense probably damaging 1.00
R7831:Ccdc51 UTSW 9 109091990 missense probably damaging 1.00
R7886:Ccdc51 UTSW 9 109091587 missense probably damaging 1.00
Z1176:Ccdc51 UTSW 9 109092148 nonsense probably null
Z1176:Ccdc51 UTSW 9 109092226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGGCCTGGAAAAGACTTGC -3'
(R):5'- TGGACATTTGCACAAAACTTCG -3'

Sequencing Primer
(F):5'- CAGTCAAATGGCTGGGGTGC -3'
(R):5'- GGTTGTGTGTACCTCAAG -3'
Posted On2015-08-18