Incidental Mutation 'R4540:Tbc1d30'
ID 333499
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission 041776-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4540 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 121099725-121187183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121115063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 365 (E365G)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect probably damaging
Transcript: ENSMUST00000064107
AA Change: E365G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: E365G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Meta Mutation Damage Score 0.3997 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,508,119 (GRCm39) H164L probably damaging Het
Arrdc3 C A 13: 81,038,790 (GRCm39) R31S possibly damaging Het
Baiap3 C T 17: 25,465,644 (GRCm39) V585M probably damaging Het
Braf A G 6: 39,621,267 (GRCm39) S391P probably damaging Het
Ccdc51 T C 9: 108,921,288 (GRCm39) F392L possibly damaging Het
Cd1d1 A G 3: 86,904,012 (GRCm39) I194T probably benign Het
Cep162 T C 9: 87,094,992 (GRCm39) K806E probably damaging Het
Cntn4 A G 6: 106,652,709 (GRCm39) E726G probably damaging Het
Col11a1 A G 3: 113,890,815 (GRCm39) Y384C unknown Het
Cops3 A T 11: 59,720,980 (GRCm39) L145H probably damaging Het
Cul9 C T 17: 46,814,015 (GRCm39) M2286I probably null Het
Echdc1 G A 10: 29,220,578 (GRCm39) V245I probably benign Het
Fsip2 A T 2: 82,782,009 (GRCm39) M261L probably benign Het
Gm4353 A G 7: 115,683,212 (GRCm39) L123P probably benign Het
Hcfc2 G C 10: 82,568,481 (GRCm39) E42Q probably benign Het
Hfm1 A C 5: 107,022,087 (GRCm39) Y199* probably null Het
Iba57 G A 11: 59,053,904 (GRCm39) probably benign Het
Ihh T A 1: 74,987,558 (GRCm39) N161I possibly damaging Het
Kcnh7 A G 2: 62,569,530 (GRCm39) S789P probably damaging Het
Kndc1 C A 7: 139,501,343 (GRCm39) C877* probably null Het
Lhcgr A G 17: 89,063,036 (GRCm39) I212T probably benign Het
Lrrtm2 T A 18: 35,346,199 (GRCm39) T368S probably benign Het
Mag A C 7: 30,600,154 (GRCm39) V500G probably damaging Het
Nadsyn1 A G 7: 143,356,960 (GRCm39) V512A probably damaging Het
Nlrp3 G A 11: 59,442,725 (GRCm39) C759Y possibly damaging Het
Nup107 T C 10: 117,597,925 (GRCm39) probably null Het
Or4c3d T C 2: 89,882,494 (GRCm39) Y58C probably damaging Het
Or4f56 T C 2: 111,703,546 (GRCm39) Y218C probably damaging Het
Pcdha1 A C 18: 37,064,680 (GRCm39) D448A probably damaging Het
Pitrm1 T A 13: 6,605,506 (GRCm39) probably null Het
Pth2r A G 1: 65,321,360 (GRCm39) N13S probably benign Het
Rae1 G T 2: 172,857,185 (GRCm39) probably benign Het
Selenoi A G 5: 30,461,085 (GRCm39) D107G probably damaging Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Spag17 C T 3: 99,995,697 (GRCm39) P1779S probably damaging Het
Supt3 T C 17: 45,347,662 (GRCm39) V208A probably benign Het
Tnxb C T 17: 34,922,309 (GRCm39) T2374I possibly damaging Het
Trip12 A G 1: 84,726,997 (GRCm39) I1T probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121,102,729 (GRCm39) utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121,132,750 (GRCm39) missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121,103,319 (GRCm39) missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121,102,956 (GRCm39) missense probably benign
IGL01844:Tbc1d30 APN 10 121,103,084 (GRCm39) missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121,103,525 (GRCm39) missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121,142,135 (GRCm39) splice site probably null
R2025:Tbc1d30 UTSW 10 121,115,051 (GRCm39) missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121,140,312 (GRCm39) missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121,108,073 (GRCm39) missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121,130,617 (GRCm39) missense probably damaging 1.00
R4624:Tbc1d30 UTSW 10 121,132,691 (GRCm39) missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121,103,121 (GRCm39) missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121,142,743 (GRCm39) missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121,138,015 (GRCm39) missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121,132,692 (GRCm39) missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121,103,479 (GRCm39) missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121,132,750 (GRCm39) missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121,130,630 (GRCm39) missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121,137,897 (GRCm39) missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121,124,870 (GRCm39) missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121,132,710 (GRCm39) missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121,183,061 (GRCm39) nonsense probably null
R7958:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121,142,104 (GRCm39) missense probably damaging 1.00
R8021:Tbc1d30 UTSW 10 121,103,448 (GRCm39) missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121,183,013 (GRCm39) nonsense probably null
R8472:Tbc1d30 UTSW 10 121,187,009 (GRCm39) missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121,103,335 (GRCm39) missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121,187,059 (GRCm39) missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121,132,716 (GRCm39) missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121,111,639 (GRCm39) missense probably benign
R9282:Tbc1d30 UTSW 10 121,142,128 (GRCm39) critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121,103,366 (GRCm39) nonsense probably null
R9531:Tbc1d30 UTSW 10 121,183,105 (GRCm39) missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121,102,886 (GRCm39) missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121,142,074 (GRCm39) missense possibly damaging 0.55
R9803:Tbc1d30 UTSW 10 121,107,980 (GRCm39) missense probably damaging 1.00
Z1176:Tbc1d30 UTSW 10 121,138,018 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121,186,969 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTACTTTGCATATATCTGAGGGC -3'
(R):5'- ATTCCTAGGGCTTTAGTTCATCTG -3'

Sequencing Primer
(F):5'- TCTAACCTTCGAGAGACTTGAGGC -3'
(R):5'- GCTAGGATCTCATGTAGCCTAGC -3'
Posted On 2015-08-18