Incidental Mutation 'R4540:Adam6a'
ID333505
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113544499 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 164 (H164L)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect probably damaging
Transcript: ENSMUST00000053086
AA Change: H164L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: H164L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CACTCATTTGGCCCAGACAC -3'
(R):5'- AAGTGGCCTTTTATAGCAGCTGG -3'

Sequencing Primer
(F):5'- TGGCCCAGACACTTGTTG -3'
(R):5'- ATAGCAGCTGGATGTGTAGC -3'
Posted On2015-08-18