Incidental Mutation 'R4541:Bag4'
ID333536
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25769488 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 228 (A228T)
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
AA Change: A228T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316
AA Change: A228T

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1103:Bag4 UTSW 8 25767863 utr 3 prime probably benign
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2045:Bag4 UTSW 8 25769488 missense probably benign
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4467:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4708:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6084:Bag4 UTSW 8 25771231 missense probably benign 0.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R7564:Bag4 UTSW 8 25777479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATAGCACTCGGAAGGCCTC -3'
(R):5'- CAGGTGTGGAGAACTTTTGGTAAC -3'

Sequencing Primer
(F):5'- TCCTACCTTAGGCTGCTGAGG -3'
(R):5'- CTGATTAATGAGTCACTAGCAGGTC -3'
Posted On2015-08-18