Incidental Mutation 'R4541:Piwil4'
ID333537
Institutional Source Beutler Lab
Gene Symbol Piwil4
Ensembl Gene ENSMUSG00000036912
Gene Namepiwi-like RNA-mediated gene silencing 4
SynonymsMiwi2, 9230101H05Rik, MIWI2
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4541 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location14696230-14740733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14718316 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 438 (M438I)
Ref Sequence ENSEMBL: ENSMUSP00000076213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]
Predicted Effect probably damaging
Transcript: ENSMUST00000076946
AA Change: M438I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: M438I

DomainStartEndE-ValueType
Pfam:ArgoN 155 300 3.7e-11 PFAM
PAZ 313 450 2.55e-67 SMART
Piwi 614 864 8.98e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115643
SMART Domains Protein: ENSMUSP00000111307
Gene: ENSMUSG00000036912

DomainStartEndE-ValueType
Blast:Piwi 1 59 5e-6 BLAST
Piwi 151 444 6.71e-126 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115644
AA Change: M391I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: M391I

DomainStartEndE-ValueType
Pfam:ArgoN 92 245 6.5e-10 PFAM
PAZ 266 403 2.55e-67 SMART
Piwi 541 834 6.71e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128327
Meta Mutation Damage Score 0.5234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Piwil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Piwil4 APN 9 14703097 missense probably damaging 1.00
IGL00331:Piwil4 APN 9 14715031 splice site probably benign
IGL00848:Piwil4 APN 9 14727411 missense probably damaging 0.98
IGL00920:Piwil4 APN 9 14727437 missense probably damaging 1.00
IGL01583:Piwil4 APN 9 14734487 missense probably damaging 1.00
IGL01690:Piwil4 APN 9 14703095 missense probably damaging 1.00
IGL01763:Piwil4 APN 9 14706266 unclassified probably null
IGL02103:Piwil4 APN 9 14725986 splice site probably null
IGL02898:Piwil4 APN 9 14706287 unclassified probably benign
IGL03037:Piwil4 APN 9 14705012 missense possibly damaging 0.88
IGL03352:Piwil4 APN 9 14725887 missense probably damaging 1.00
PIT4651001:Piwil4 UTSW 9 14708899 missense possibly damaging 0.48
R0453:Piwil4 UTSW 9 14727452 missense probably benign 0.00
R2324:Piwil4 UTSW 9 14736908 missense possibly damaging 0.88
R3236:Piwil4 UTSW 9 14700248 unclassified probably benign
R3408:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3689:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3844:Piwil4 UTSW 9 14729960 missense possibly damaging 0.54
R4191:Piwil4 UTSW 9 14715000 missense probably damaging 0.99
R4505:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4506:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4652:Piwil4 UTSW 9 14712308 nonsense probably null
R4876:Piwil4 UTSW 9 14740465 missense probably benign 0.22
R5027:Piwil4 UTSW 9 14709944 missense probably damaging 1.00
R5479:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R6656:Piwil4 UTSW 9 14709934 missense probably damaging 1.00
R6736:Piwil4 UTSW 9 14715823 missense probably benign
R7096:Piwil4 UTSW 9 14736816 nonsense probably null
R7124:Piwil4 UTSW 9 14736900 missense probably benign
R7358:Piwil4 UTSW 9 14729993 missense possibly damaging 0.82
R7371:Piwil4 UTSW 9 14727433 missense probably benign 0.08
R7419:Piwil4 UTSW 9 14702395 missense probably damaging 1.00
R7467:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R7571:Piwil4 UTSW 9 14734597 missense probably benign 0.08
R7644:Piwil4 UTSW 9 14734415 intron probably null
X0026:Piwil4 UTSW 9 14740591 utr 5 prime probably benign
X0064:Piwil4 UTSW 9 14708875 missense probably benign 0.00
Z1088:Piwil4 UTSW 9 14734517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGTTGGCAAGCTTAGAC -3'
(R):5'- AGGCTGAGATCACCATGTTCAAG -3'

Sequencing Primer
(F):5'- GTTGGCAAGCTTAGACATTCTTATC -3'
(R):5'- GATCACCATGTTCAAGACTCCTAGG -3'
Posted On2015-08-18