Incidental Mutation 'R4541:Nlrp1c-ps'
ID333542
Institutional Source Beutler Lab
Gene Symbol Nlrp1c-ps
Ensembl Gene ENSMUSG00000092528
Gene NameNLR family, pyrin domain containing 1C, pseudogene
SynonymsNalp1c, OTTMUSG00000006090
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location71242430-71285232 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 71280880 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174668
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Nlrp1c-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2292:Nlrp1c-ps UTSW 11 71246362 critical splice donor site noncoding transcript
R4120:Nlrp1c-ps UTSW 11 71242533 exon noncoding transcript
R4670:Nlrp1c-ps UTSW 11 71280556 exon noncoding transcript
R4812:Nlrp1c-ps UTSW 11 71252305 exon noncoding transcript
R4826:Nlrp1c-ps UTSW 11 71242517 exon noncoding transcript
R4904:Nlrp1c-ps UTSW 11 71242628 exon noncoding transcript
R4911:Nlrp1c-ps UTSW 11 71260369 exon noncoding transcript
R5128:Nlrp1c-ps UTSW 11 71279595 exon noncoding transcript
R5355:Nlrp1c-ps UTSW 11 71258013 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCCTGATCCTTCAAGACCCATG -3'
(R):5'- GCTCAAAGACATTTGCCAGG -3'

Sequencing Primer
(F):5'- AAGACCCATGCTGGCTCATCTATG -3'
(R):5'- AGCTGGCATCAATGTGTACC -3'
Posted On2015-08-18