Incidental Mutation 'R4541:Kcnk10'
ID333548
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Namepotassium channel, subfamily K, member 10
Synonyms
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98429437-98578310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98436277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 301 (I301T)
Ref Sequence ENSEMBL: ENSMUSP00000152473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113] [ENSMUST00000221240]
Predicted Effect probably damaging
Transcript: ENSMUST00000110113
AA Change: I287T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854
AA Change: I287T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221240
AA Change: I301T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98518533 missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98490063 missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98518840 splice site probably benign
R0467:Kcnk10 UTSW 12 98489945 missense probably benign 0.43
R0558:Kcnk10 UTSW 12 98436301 missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98440685 missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98518670 missense possibly damaging 0.93
R1036:Kcnk10 UTSW 12 98496186 splice site probably benign
R1398:Kcnk10 UTSW 12 98436226 missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98489948 missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98496288 missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98435289 missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98489912 missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98440744 missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98434946 missense probably benign 0.03
R4605:Kcnk10 UTSW 12 98489960 missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98435159 missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98434902 missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98440687 missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98435301 missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98434995 missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98489932 missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98440772 missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98518743 nonsense probably null
R7611:Kcnk10 UTSW 12 98518640 missense probably damaging 1.00
R7687:Kcnk10 UTSW 12 98435096 missense probably damaging 0.97
X0067:Kcnk10 UTSW 12 98518824 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCCATTGTGCAACCATGTG -3'
(R):5'- AGACTCCAGTTTCTGTTAGGTC -3'

Sequencing Primer
(F):5'- CATTGTGCAACCATGTGCTGAAAAAG -3'
(R):5'- GTTTCCCACAAGCCTAATGGTCTAG -3'
Posted On2015-08-18