Incidental Mutation 'R0107:Chuk'
ID33356
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0107 (G1)
Quality Score223
Status Validated (trace)
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44096919 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 263 (S263C)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: S263C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: S263C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119591
AA Change: S263C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: S263C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Meta Mutation Damage Score 0.1669 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTTCCTCAGTCACACTAAGCGCC -3'
(R):5'- GCTCTTTGAAAATAAGCCGTACACAGC -3'

Sequencing Primer
(F):5'- ACACTAAGCGCCCCTCC -3'
(R):5'- CACAGCCACTGTGGATTATTG -3'
Posted On2013-05-09