Incidental Mutation 'R0107:Gbf1'
ID 33357
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Name golgi-specific brefeldin A-resistance factor 1
Synonyms 1700083E03Rik
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0107 (G1)
Quality Score 178
Status Validated (trace)
Chromosome 19
Chromosomal Location 46152509-46286510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46284828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1709 (V1709A)
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]
AlphaFold Q6DFZ1
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: V1767A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: V1767A

low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175706
Predicted Effect probably benign
Transcript: ENSMUST00000175747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176576
Predicted Effect probably benign
Transcript: ENSMUST00000176992
AA Change: V1709A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: V1709A

low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
R8716:Gbf1 UTSW 19 46284021 missense probably damaging 1.00
R8851:Gbf1 UTSW 19 46268483 missense probably damaging 1.00
R9424:Gbf1 UTSW 19 46259683 missense probably benign 0.00
R9435:Gbf1 UTSW 19 46279993 missense probably benign 0.42
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctagccttcactactctgagac -3'
Posted On 2013-05-09