Incidental Mutation 'R4542:Olfr707'
ID 333579
Institutional Source Beutler Lab
Gene Symbol Olfr707
Ensembl Gene ENSMUSG00000069390
Gene Name olfactory receptor 707
Synonyms MOR260-8P, GA_x6K02T2PBJ9-9276470-9275547
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R4542 (G1)
Quality Score 217
Status Not validated
Chromosome 7
Chromosomal Location 106890446-106901241 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) GAACAACAACAA to GAACAACAA at 106891360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
AlphaFold K7N662
Predicted Effect probably benign
Transcript: ENSMUST00000088687
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208759
Predicted Effect probably benign
Transcript: ENSMUST00000209025
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect probably benign
Transcript: ENSMUST00000213918
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216099
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Olfr707
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr707 APN 7 106891329 missense probably damaging 1.00
R1539:Olfr707 UTSW 7 106891276 missense probably damaging 1.00
R1768:Olfr707 UTSW 7 106891977 splice site probably null
R1768:Olfr707 UTSW 7 106891978 missense probably damaging 0.97
R4367:Olfr707 UTSW 7 106891360 small deletion probably benign
R4874:Olfr707 UTSW 7 106891435 missense probably benign 0.28
R6164:Olfr707 UTSW 7 106891928 nonsense probably null
R8124:Olfr707 UTSW 7 106891881 missense possibly damaging 0.91
R8883:Olfr707 UTSW 7 106891329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTAACTGGCTTCAAATTCCC -3'
(R):5'- TGGCATCGGCAGATACATACAG -3'

Sequencing Primer
(F):5'- CCCATGGCCCTGAACTATTTTAAAG -3'
(R):5'- GCACAGAGATGGCGATCTTTGC -3'
Posted On 2015-08-18