Incidental Mutation 'R4542:Sost'
ID333596
Institutional Source Beutler Lab
Gene Symbol Sost
Ensembl Gene ENSMUSG00000001494
Gene Namesclerostin
Synonyms5430411E23Rik
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101962458-101967015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101966844 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 44 (P44S)
Ref Sequence ENSEMBL: ENSMUSP00000001534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]
Predicted Effect probably damaging
Transcript: ENSMUST00000001534
AA Change: P44S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: P44S

DomainStartEndE-ValueType
Pfam:Sclerostin 1 208 8e-98 PFAM
Pfam:DAN 51 168 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176599
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Sost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Sost APN 11 101966879 missense probably damaging 1.00
IGL02487:Sost APN 11 101966807 missense possibly damaging 0.64
IGL02967:Sost APN 11 101964258 missense possibly damaging 0.50
R0724:Sost UTSW 11 101966918 missense probably benign 0.04
R1873:Sost UTSW 11 101964243 missense probably damaging 1.00
R2182:Sost UTSW 11 101963850 missense probably damaging 1.00
R3429:Sost UTSW 11 101964039 missense probably damaging 1.00
R4428:Sost UTSW 11 101966844 missense probably damaging 0.97
R4430:Sost UTSW 11 101966844 missense probably damaging 0.97
R4464:Sost UTSW 11 101966844 missense probably damaging 0.97
R4537:Sost UTSW 11 101966844 missense probably damaging 0.97
R4539:Sost UTSW 11 101966844 missense probably damaging 0.97
R4540:Sost UTSW 11 101966844 missense probably damaging 0.97
R4541:Sost UTSW 11 101966844 missense probably damaging 0.97
R4710:Sost UTSW 11 101966844 missense probably damaging 0.97
R5125:Sost UTSW 11 101963941 missense probably damaging 1.00
R7297:Sost UTSW 11 101964103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGTCCCTGCCCTGATG -3'
(R):5'- AACCGTATCTAGGCTGGACAC -3'

Sequencing Primer
(F):5'- TGCCCTGATGTAGCAGAGG -3'
(R):5'- TATCTAGGCTGGACACTGGAGC -3'
Posted On2015-08-18