Incidental Mutation 'R4542:Crip1'
ID333600
Institutional Source Beutler Lab
Gene Symbol Crip1
Ensembl Gene ENSMUSG00000006360
Gene Namecysteine-rich protein 1 (intestinal)
SynonymsCRP1, Crip
MMRRC Submission 041593-MU
Accession Numbers

Ncbi RefSeq: NM_007763.3; MGI:88501

Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113146316-113153879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113153489 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 108 (Y108C)
Ref Sequence ENSEMBL: ENSMUSP00000142803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006523] [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000199089] [ENSMUST00000200522] [ENSMUST00000200553]
Predicted Effect probably damaging
Transcript: ENSMUST00000006523
AA Change: Y57C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006523
Gene: ENSMUSG00000006360
AA Change: Y57C

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049271
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196505
Predicted Effect probably benign
Transcript: ENSMUST00000196755
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198909
Predicted Effect probably damaging
Transcript: ENSMUST00000199089
AA Change: Y108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360
AA Change: Y108C

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199382
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Predicted Effect probably damaging
Transcript: ENSMUST00000200553
AA Change: Y57C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143680
Gene: ENSMUSG00000006360
AA Change: Y57C

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(8) : Targeted(2) Gene trapped(6)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Crip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Crip1 APN 12 113152135 missense probably damaging 1.00
IGL00562:Crip1 APN 12 113153612 splice site probably null
IGL00563:Crip1 APN 12 113153612 splice site probably null
R0030:Crip1 UTSW 12 113153376 critical splice donor site probably null
R1879:Crip1 UTSW 12 113153332 missense probably damaging 1.00
R5918:Crip1 UTSW 12 113153667 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCCTGAAGTGTGAGAAATG -3'
(R):5'- AGGGATGACTCTGTCCTGTAAAC -3'

Sequencing Primer
(F):5'- TGTGGAAAGACACTGACCTCTG -3'
(R):5'- GGCTATACCTCGGTCTACTTGAAAG -3'
Posted On2015-08-18