Incidental Mutation 'R0207:Tns1'
ID33361
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0207 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 73937318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000191104] [ENSMUST00000212888] [ENSMUST00000212888]
Predicted Effect probably null
Transcript: ENSMUST00000169786
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169786
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185331
Predicted Effect probably null
Transcript: ENSMUST00000185331
Predicted Effect probably null
Transcript: ENSMUST00000185702
Predicted Effect probably null
Transcript: ENSMUST00000185702
Predicted Effect probably null
Transcript: ENSMUST00000187584
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187584
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189228
Predicted Effect probably null
Transcript: ENSMUST00000191104
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191104
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212888
Predicted Effect probably null
Transcript: ENSMUST00000212888
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R7570:Tns1 UTSW 1 73953479 missense probably damaging 1.00
R7670:Tns1 UTSW 1 73952477 missense possibly damaging 0.93
R7769:Tns1 UTSW 1 73953371 missense probably damaging 0.99
R7833:Tns1 UTSW 1 74091331 intron probably benign
R7916:Tns1 UTSW 1 74091331 intron probably benign
R8052:Tns1 UTSW 1 73953437 missense probably damaging 1.00
Z1177:Tns1 UTSW 1 74002307 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAGGTCTCAAAATCCTAAGGCCCAG -3'
(R):5'- TCTCTTAGTAGTGGGCAAGGGTCAG -3'

Sequencing Primer
(F):5'- AAACCTCTGCTCTGTGAGGAATC -3'
(R):5'- TCAGGACAGGGTGTCACTTC -3'
Posted On2013-05-09