Incidental Mutation 'R4543:Lrrcc1'
ID333614
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Nameleucine rich repeat and coiled-coil domain containing 1
Synonyms
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4543 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14533788-14572658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14539791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 109 (I109K)
Ref Sequence ENSEMBL: ENSMUSP00000128733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000169079]
Predicted Effect probably damaging
Transcript: ENSMUST00000091325
AA Change: I231K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: I231K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108370
AA Change: I231K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: I231K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163660
AA Change: I109K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: I109K

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165436
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169079
AA Change: I231K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: I231K

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14536128 missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14536541 critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14548226 missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14547272 missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14554357 nonsense probably null
IGL03123:Lrrcc1 APN 3 14536084 missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14545596 missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14565849 missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14558356 missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14559374 missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14557273 missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14540119 splice site probably benign
R0635:Lrrcc1 UTSW 3 14559228 missense probably benign 0.11
R1355:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1370:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14537363 missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14559225 unclassified probably benign
R1946:Lrrcc1 UTSW 3 14550393 missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14547255 missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14563024 missense probably damaging 1.00
R2392:Lrrcc1 UTSW 3 14536520 missense probably damaging 1.00
R4105:Lrrcc1 UTSW 3 14550328 missense probably benign 0.21
R4464:Lrrcc1 UTSW 3 14557318 missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14551443 missense probably damaging 1.00
R4718:Lrrcc1 UTSW 3 14536032 missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14562285 missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14536096 nonsense probably null
R4841:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14562126 missense possibly damaging 0.69
R6338:Lrrcc1 UTSW 3 14547316 missense possibly damaging 0.48
R7001:Lrrcc1 UTSW 3 14540095 missense probably damaging 0.99
R7036:Lrrcc1 UTSW 3 14563009 missense possibly damaging 0.80
R7342:Lrrcc1 UTSW 3 14554371 missense probably benign
R8038:Lrrcc1 UTSW 3 14565830 missense not run
Predicted Primers PCR Primer
(F):5'- CCTAGTAGCTTGGTTGGCTTTAGAC -3'
(R):5'- AGGCTAAAACATTGTCTTCTGGTG -3'

Sequencing Primer
(F):5'- AGCTTGGTTGGCTTTAGACATAATC -3'
(R):5'- TGTCTTCTGGTGTACTTTTAAATTCC -3'
Posted On2015-08-18